Difference between revisions of "Part:BBa K1796008"

 
 
(2 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1796008 short</partinfo>
 
<partinfo>BBa_K1796008 short</partinfo>
Line 6: Line 5:
 
We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves&#65288;done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline.
 
We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves&#65288;done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline.
 
Sequence submit is promoted by the synthesis company, containing a PstI in the gene.
 
Sequence submit is promoted by the synthesis company, containing a PstI in the gene.
The sequence we promoted: CAGGAGGGAGGAATAGGCCAAATGTCTTCTATCGTTGACAAAGGTAAACAGATCGTTGAAGAAATCCTGGAAGTTTACCCGAAAAAAGCTAAAAAAGACCGTACCAAACACTTCGAAATCGCTGACGAAGAACTGGTTAACTGCGGTACCTGCTCTATCAAATCTAACATGAAATCTCGTCCGGGTGTTATGACCGCTCGTGGTTGCGCTTACGCTGGTTCTAAAGGTGTTGTTTGGGGTCCGATCAAAGACATGGTTCACATCTCTCACGGTCCGATCGGTTGCGGTCAGTACTCTTGGGGTACCCGTCGTAACTACGCTAACGGTATCCTGGGTATCGACAACTTCACCGCTATGCAGATCACCTCTAACTTCCAGGAAAAAGACATCGTTTTCGGTGGTGACAAAAAACTGGAAGTTATCTGCCGTGAAATCAAAGAAATGTTCCCGCTGGCTAAAGGTATCTCTGTTCAGTCTGAATGCCCGGTTGGTCTGATCGGTGACGACATCGGTGCTGTTGCTAAAAAAATGACCGAAGAACTGGGTATCCCGGTTATCCCGGTTCGTTGCGAAGGTTTCCGTGGTGTTTCTCAGTCTCTGGGTCACCACATCGCTAACGACGCTATCCGTGACTTCCTGATGGGTCGTCGTGAACTGAAAGAATGCGGTCCGTACGACGTTTCTATCATCGGTGACTACAACATCGGTGGTGACGCTTGGGCTTCTCGTATCCTGCTGGAAGAAATGGGTCTGCGTGTTATCGCTCAGTGGTCTGGTGACGGTACCATCAACGAACTGGGTATCGCTCACAAATCTAAACTGAACCTGATCCACTGCCACCGTTCTATGAACTACATGTGCACCACCATGGAACAGGAATACGGTATCCCGTGGATGGAATACAACTTCTTCGGTCCGACCAAAACCATGGAATCTCTGCGTGCTATCGCTGCTCGTTTCGACGAAACCATCCAGGAAAAATGCGAACAGGTTATCGCTCAGTACATGCCGCAGATGGAAGCTGTTATCCGTAAATACCGTCCGCGTCTGGAAGGTAAAAAAGTTATGCTGCTGATCGGTGGTCTGCGTGCTCGTCACACCATCGGTGCTTACGAAGACCTGGGTATGGAAATCGTTGCTACCGGTTACGAATTTGCTCACAAAGACGACTACGAAAAAACCTTCCCGGACGTTAAAGAAGGTACCATCCTGTACGACGACCCGACCGCTTACGAACTGGAAGAACTGGCTCAGCGTCTGAACATCGACCTGATGGGTGCTGGTGTTAAAGAAAAATACGTTTACCACAAAATGGGTATCCCGTTCCGTCAGATGCACTCTTGGGACTACTCTGGTCCATACCACGGGTTTGACGGCTTCAAGATCTTCGCGCGTGACATGGACATGACCATCAACTCTCCGGTTTGGTCTCTGCTGCCGTCTCGTCAGACCGCTGAAGTTCCGGTTTAATAA
+
 
  
  
Line 15: Line 14:
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K1796008 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1796008 SequenceAndFeatures</partinfo>
 +
==Parameter of Protein==
 +
<p> Number of amino acids: 482 </p>
 +
<p> </p>
 +
<p> Molecular weight: 54220.4 </p>
 +
<p> </p>
 +
<p> Theoretical pI: 6.06 </p>
 +
<p> </p>
 +
<p> Amino acid composition:  </p>
 +
<p> </p>
 +
<p> Ala (A)  30      6.2% </p>
 +
<p> </p>
 +
<p> Arg (R)  25      5.2% </p>
 +
<p> </p>
 +
<p> Asn (N)  14      2.9% </p>
 +
<p> </p>
 +
<p> Asp (D)  27      5.6% </p>
 +
<p> </p>
 +
<p> Cys (C)  11      2.3% </p>
 +
<p> </p>
 +
<p> Gln (Q)  15      3.1% </p>
 +
<p> </p>
 +
<p> Glu (E)  38      7.9% </p>
 +
<p> </p>
 +
<p> Gly (G)  47      9.8% </p>
 +
<p> </p>
 +
<p> His (H)  13      2.7% </p>
 +
<p> </p>
 +
<p> Ile (I)  42      8.7% </p>
 +
<p> </p>
 +
<p> Leu (L)  29      6.0% </p>
 +
<p> </p>
 +
<p> Lys (K)  33      6.8% </p>
 +
<p> </p>
 +
<p> Met (M)  23      4.8% </p>
 +
<p> </p>
 +
<p> Phe (F)  16      3.3% </p>
 +
<p> </p>
 +
<p> Pro (P)  20      4.1% </p>
 +
<p> </p>
 +
<p> Ser (S)  24      5.0% </p>
 +
<p> </p>
 +
<p> Thr (T)  20      4.1% </p>
 +
<p> </p>
 +
<p> Trp (W)  7      1.5% </p>
 +
<p> </p>
 +
<p> Tyr (Y)  20      4.1% </p>
 +
<p> </p>
 +
<p> Val (V)  28      5.8% </p>
 +
<p> </p>
 +
<p> Pyl (O)  0      0.0% </p>
 +
<p> </p>
 +
<p> Sec (U)  0      0.0% </p>
 +
<p> </p>
 +
<p> (B)  0          0.0% </p>
 +
<p> </p>
 +
<p> (Z)  0          0.0% </p>
 +
<p> </p>
 +
<p> (X)  0          0.0% </p>
 +
<p> </p>
 +
<p> Total number of negatively charged residues (Asp + Glu): 65 </p>
 +
<p> Total number of positively charged residues (Arg + Lys): 58 </p>
 +
<p> </p>
 +
<p> Atomic composition:Carbon      C              2406 </p>
 +
<p> Hydrogen    H        3774 </p>
 +
<p> Nitrogen    N          652 </p>
 +
<p> Oxygen      O          706 </p>
 +
<p> Sulfur      S          34 </p>
 +
<p> </p>
 +
<p> Formula: C2406H3774N652O706S34Total number of atoms: 7572 </p>
 +
<p> </p>
 +
<p> Extinction coefficients:Extinction coefficients are in units of  M-1 cm-1, at 280 nm measured in water. </p>
 +
<p> </p>
 +
<p> Ext. coefficient    68925 </p>
 +
<p> Abs 0.1% (=1 g/l)  1.271, assuming all pairs of Cys residues form cystines </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> Ext. coefficient    68300 </p>
 +
<p> Abs 0.1% (=1 g/l)  1.260, assuming all Cys residues are reduced </p>
 +
<p> </p>
 +
<p> Estimated half-life:The N-terminal of the sequence considered is M (Met). </p>
 +
<p> </p>
 +
<p> The estimated half-life is: 30 hours (mammalian reticulocytes, in vitro). </p>
 +
<p>                             >20 hours (yeast, in vivo). </p>
 +
<p>                             >10 hours (Escherichia coli, in vivo). </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> Instability index:The instability index (II) is computed to be 42.80 </p>
 +
<p> This classifies the protein as unstable. </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> Aliphatic index: 80.52 </p>
 +
<p> </p>
 +
<p> Grand average of hydropathicity (GRAVY): -0.293 </p>
 +
<p> Aliphatic index: 92.50 </p>
 +
<p> </p>
 +
<p> Grand average of hydropathicity (GRAVY): -0.161 </p>
  
  

Latest revision as of 01:33, 19 September 2015

nifD promoted from Paenibacillus sp. WLY78

Function: αsubunits of dinitrogease which also called FeMo protein. NifD encode a metallocluster: FeMo-co, a [Mo-7Fe-9S-C-homocitrate] cluster which serves as the active site of substrate binding and reduction. We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves(done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline. Sequence submit is promoted by the synthesis company, containing a PstI in the gene.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 150
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 150
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1116
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 150
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 150
    Illegal AgeI site found at 1141
  • 1000
    COMPATIBLE WITH RFC[1000]

Parameter of Protein

Number of amino acids: 482

Molecular weight: 54220.4

Theoretical pI: 6.06

Amino acid composition: 

Ala (A) 30 6.2%

Arg (R) 25 5.2%

Asn (N) 14 2.9%

Asp (D) 27 5.6%

Cys (C) 11 2.3%

Gln (Q) 15 3.1%

Glu (E) 38 7.9%

Gly (G) 47 9.8%

His (H) 13 2.7%

Ile (I) 42 8.7%

Leu (L) 29 6.0%

Lys (K) 33 6.8%

Met (M) 23 4.8%

Phe (F) 16 3.3%

Pro (P) 20 4.1%

Ser (S) 24 5.0%

Thr (T) 20 4.1%

Trp (W) 7 1.5%

Tyr (Y) 20 4.1%

Val (V) 28 5.8%

Pyl (O) 0 0.0%

Sec (U) 0 0.0%

(B) 0 0.0%

(Z) 0 0.0%

(X) 0 0.0%

Total number of negatively charged residues (Asp + Glu): 65

Total number of positively charged residues (Arg + Lys): 58

Atomic composition:Carbon C 2406

Hydrogen H 3774

Nitrogen N 652

Oxygen O 706

Sulfur S 34

Formula: C2406H3774N652O706S34Total number of atoms: 7572

Extinction coefficients:Extinction coefficients are in units of M-1 cm-1, at 280 nm measured in water.

Ext. coefficient 68925

Abs 0.1% (=1 g/l) 1.271, assuming all pairs of Cys residues form cystines

Ext. coefficient 68300

Abs 0.1% (=1 g/l) 1.260, assuming all Cys residues are reduced

Estimated half-life:The N-terminal of the sequence considered is M (Met).

The estimated half-life is: 30 hours (mammalian reticulocytes, in vitro).

>20 hours (yeast, in vivo).

>10 hours (Escherichia coli, in vivo).

Instability index:The instability index (II) is computed to be 42.80

This classifies the protein as unstable.

Aliphatic index: 80.52

Grand average of hydropathicity (GRAVY): -0.293

Aliphatic index: 92.50

Grand average of hydropathicity (GRAVY): -0.161