Difference between revisions of "Part:BBa K1773003:Design"
(→Design Notes) |
|||
(6 intermediate revisions by 2 users not shown) | |||
Line 6: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | Gene mutagenesis was performed using Invitrogen GeneArt® Site-Directed Mutagenesis PLUS System kit. | |
+ | These mutagenic primers were used: | ||
− | + | EcoRI mutagenesis: <br /> | |
+ | F: cgttttcaatggcagaatccggcatttgatttggca<br /> | ||
+ | R: tgccaaatcaaatgccggattctgccattgaaaacg<br /> | ||
− | + | XbaI Mutagenesis:<br /> | |
+ | F: cgatcatcattattcttctctggatgctgatgttaatttggg<br /> | ||
+ | R: cccaaattaacatcagcatccagagaagaataatgatgatcg<br /> | ||
− | + | PstI Mutagenesis:<br /> | |
+ | F: gaagactgaactgcctgcggttaaacaacataaac<br /> | ||
+ | Re: gtttatgttgtttaaccgcaggcagttcagtcttc<br /> | ||
− | |||
+ | Primers for adding Biobrick prefix and suffix: | ||
− | + | Fw: ttaaggaattcgcggccgcttctagatgaatatcttacttgttagccaatgccaaaaaaa | |
− | + | Rev: cggctgcagcggccgctactagtagagatcttcctgccaaaaacccagcgttt | |
− | + | ||
− | + | ||
− | + | ||
− | + |
Latest revision as of 15:11, 10 September 2015
I-F type CRISPR-Cas Cas3 gene
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2623
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1344
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2307
Illegal AgeI site found at 2680 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
Gene mutagenesis was performed using Invitrogen GeneArt® Site-Directed Mutagenesis PLUS System kit.
These mutagenic primers were used:
EcoRI mutagenesis:
F: cgttttcaatggcagaatccggcatttgatttggca
R: tgccaaatcaaatgccggattctgccattgaaaacg
XbaI Mutagenesis:
F: cgatcatcattattcttctctggatgctgatgttaatttggg
R: cccaaattaacatcagcatccagagaagaataatgatgatcg
PstI Mutagenesis:
F: gaagactgaactgcctgcggttaaacaacataaac
Re: gtttatgttgtttaaccgcaggcagttcagtcttc
Primers for adding Biobrick prefix and suffix:
Fw: ttaaggaattcgcggccgcttctagatgaatatcttacttgttagccaatgccaaaaaaa
Rev: cggctgcagcggccgctactagtagagatcttcctgccaaaaacccagcgttt