Difference between revisions of "Part:BBa K1668004:Design"

 
(Design Notes)
 
(7 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
+
----
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1668004 short</partinfo>
 
<partinfo>BBa_K1668004 short</partinfo>
 
+
<br>
 +
<br>
 +
ermEp is a strong constitutive promoter in various S. avermitilis strains. It should be noticed that ermEp can only be expressed in S.avermitilis strains instead of Escherichia coli or any other chassis.
 +
<br>
 +
<br>
 
<partinfo>BBa_K1668004 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1668004 SequenceAndFeatures</partinfo>
 
+
<br>
 
+
<br>
 +
===Source===
 +
The metK gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.
 +
<br>
 +
<br>
 
===Design Notes===
 
===Design Notes===
We use seamless assembly.
 
  
 +
<h4>PCR</h4>
 +
The ermEp gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.
 +
By PCR with primers ermEp1 and ermEp2 shown below, we added the standard prefix and suffix at both ends of the metK sequence.
  
 +
<h4>Seamless assembly</h4>
 +
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
 +
<br>
 +
ermEp1 (F, 5’-3’): ATTCGCGGCCGCTTCTAGAGGGCGGCTTGCGCC
 +
<br>
 +
ermEp2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATACCAACCGGCACGAT
  
===Source===
+
<h4>Transformation and confirmation</h4>
 +
After seamless assembly, standard plasmid pSB1C3 containing ermEp gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers.
 +
The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
  
The metK gene was amplified by PCR with genomic DNA of S. avermitilis(&#20855;&#20307;&#22411;&#21495;) as template using primers metK1 and metK2&#65288;
+
<h4>Plasmid map</h4>
 +
[[File:ZJU-CHINA_ermEp_map.png|300px|thumb|left|Fig.3 the plasmid map of BBa_K1668001]]
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
  
 
===References===
 
===References===
 +
Siegl, T., et al. (2013). "Design, construction and characterisation of a synthetic promoter library for fine-tuned gene expression in actinomycetes." Metab Eng 19: 98-106.
 +
<br>
 +
<br>
 +
Bibb, M. J., et al. (1994). "The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site." Mol Microbiol 14(3): 533-545.
 +
<br>

Latest revision as of 16:50, 16 September 2015


ermEp (a strong constitutive promoter in S. avermitilis)

ermEp is a strong constitutive promoter in various S. avermitilis strains. It should be noticed that ermEp can only be expressed in S.avermitilis strains instead of Escherichia coli or any other chassis.


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Source

The metK gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.

Design Notes

PCR

The ermEp gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers ermEp1 and ermEp2 shown below, we added the standard prefix and suffix at both ends of the metK sequence.

Seamless assembly

We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
ermEp1 (F, 5’-3’): ATTCGCGGCCGCTTCTAGAGGGCGGCTTGCGCC
ermEp2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATACCAACCGGCACGAT

Transformation and confirmation

After seamless assembly, standard plasmid pSB1C3 containing ermEp gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.

Plasmid map

Fig.3 the plasmid map of BBa_K1668001
























References

Siegl, T., et al. (2013). "Design, construction and characterisation of a synthetic promoter library for fine-tuned gene expression in actinomycetes." Metab Eng 19: 98-106.

Bibb, M. J., et al. (1994). "The mRNA for the 23S rRNA methylase encoded by the ermE gene of Saccharopolyspora erythraea is translated in the absence of a conventional ribosome-binding site." Mol Microbiol 14(3): 533-545.