Difference between revisions of "Part:BBa K1722001:Design"

(→‎Source)
(→‎References)
 
(2 intermediate revisions by the same user not shown)
Line 12: Line 12:
 
===Source===
 
===Source===
  
−
The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function is also carried out in Shenzhen Second People's Hospital.
+
The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.
  
 
===References===
 
===References===
−
[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG (2003). "[Telomerase: an enzyme with multiple applications in cancer research]". Rev. Invest. Clin. 54 (4): 342–8. PMID 12415959
+
[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG. Telomerase: an enzyme with multiple applications in cancer research. Rev. Invest. Clin. 54 (4): 342–8. 
−
[2]recurrent tert promoter mutations identified in a large-scale study of multiple tumour types are associated with increased tert expression and telomerase activation.PMID:25843513
+
 
 +
[2]Huang DS, Wang ZH, He XJ, et al. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation, European Journal of Cancer, 51: 969-976.
 +
 
 +
[3]Zhuang CL, Fu X, Liu L, et al. Synthetic miRNA sponges driven by mutant hTERT promoter selectively inhibit the progression of bladder cancer. Tumor Biol. 2015
 +
 
 +
[4]Wu S, Huang P, Li C, Huang Y, Li X, Wang Y, et al. Telomerase reverase transcriptase gene promotor mutations help discern the origin of urogenital tumors: a genomic and molecular study. Eur Urol. 2014;65(2):274–7.

Latest revision as of 07:12, 8 September 2015

shTERT is a cancer cell specific promoter with high efficiency.


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.


Source

The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.

References

[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG. Telomerase: an enzyme with multiple applications in cancer research. Rev. Invest. Clin. 54 (4): 342–8. 

[2]Huang DS, Wang ZH, He XJ, et al. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation, European Journal of Cancer, 51: 969-976.

[3]Zhuang CL, Fu X, Liu L, et al. Synthetic miRNA sponges driven by mutant hTERT promoter selectively inhibit the progression of bladder cancer. Tumor Biol. 2015

[4]Wu S, Huang P, Li C, Huang Y, Li X, Wang Y, et al. Telomerase reverase transcriptase gene promotor mutations help discern the origin of urogenital tumors: a genomic and molecular study. Eur Urol. 2014;65(2):274–7.