Difference between revisions of "Part:BBa K1110003"

(Usage and Biology)
 
(2 intermediate revisions by the same user not shown)
Line 4: Line 4:
 
Codes for the peptide Mambalgin-1, an analgesic
 
Codes for the peptide Mambalgin-1, an analgesic
  
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
  
Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba.  Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes.
+
Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba.  Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes.  
 +
This is intended for use in yeast, specifically ''Pichia Pastoris''
 +
 
 +
<!-- Add more about the biology of this part here
 +
 
  
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K1110003 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1110003 SequenceAndFeatures</partinfo>
CTGAAATGTTACCAACATGGTAAAGTTGTGACTTGTCATCGAGATATGAAGTTTTGCTATCATAACACTGGCATGCCTTTTCGAAATCTCAAGCTCATCCTACAGGGATGTTCTTCTTCGTGCAGTGAAACAGAAAACAATAAGTGTTGCTCAACAGACAGATGCAACAAA
 
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 17:02, 31 August 2015

Mambalgin-1 cDNA

Codes for the peptide Mambalgin-1, an analgesic

Usage and Biology

Mambalgin is a protein component of the venom of Dendroaspis polylepis, better known as the Black Mamba. Mambalgin-1 peptide that is a powerful analgesic that directly blocks pain transmission in the peripheral nervous system (Diochot et al, 2012) by targeting acid-sensing ion channels within nociceptors beneath the epidermis. Because Mambalgin acts on pain receptors within the skin rather than on opioid receptors in the brain, this peptide has great potential as a medication for pain treatment that is non-addicting and non-habit forming. Furthermore, recombinant purification of Mambalgin could assist in developing anti-venom without the attendant risk of harvesting venom directly from snakes. This is intended for use in yeast, specifically Pichia Pastoris

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]