Difference between revisions of "Part:BBa K310004:Experience"
Sarahwideman (Talk | contribs) (→Stockholm 2015 iGEM Team) |
Sarahwideman (Talk | contribs) (→Stockholm 2015 iGEM Team) |
||
(5 intermediate revisions by the same user not shown) | |||
Line 16: | Line 16: | ||
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica. | We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica. | ||
+ | |||
+ | '''Restriction analysis of BBa_K310004''' | ||
[[File:K310004 restriction analysis Stockholm 2015.png|border|Restriction Analysis]] | [[File:K310004 restriction analysis Stockholm 2015.png|border|Restriction Analysis]] | ||
− | '''Left''': | + | '''Left''': Restriction analysis gel of BBa_K310004 in pSB1C3. |
+ | |||
+ | '''Middle''': Gel simulated in SnapGene using BBa_K310004 sequence, provided by UIUC Illinois 2010 iGEM Team. | ||
− | ''' | + | '''Right''': Gel simulated in SnapGene using BBa_K310004 sequence, provided by Stockholm 2015 iGEM Team. |
− | |||
+ | '''BBa_K310004 sequence contributed by Stockholm 2015''' | ||
>BBa_K310004 Part-only sequence (684 bp) | >BBa_K310004 Part-only sequence (684 bp) | ||
Line 53: | Line 57: | ||
<I>Stockholm 2015</I> | <I>Stockholm 2015</I> | ||
|width='60%' valign='top'| | |width='60%' valign='top'| | ||
− | This part | + | This part is not the MicF target. |
|}; | |}; |
Latest revision as of 21:03, 19 August 2015
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
Applications of BBa_K310004
Stockholm 2015 iGEM Team
This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
Restriction analysis of BBa_K310004
Left: Restriction analysis gel of BBa_K310004 in pSB1C3.
Middle: Gel simulated in SnapGene using BBa_K310004 sequence, provided by UIUC Illinois 2010 iGEM Team.
Right: Gel simulated in SnapGene using BBa_K310004 sequence, provided by Stockholm 2015 iGEM Team.
BBa_K310004 sequence contributed by Stockholm 2015
>BBa_K310004 Part-only sequence (684 bp) AAAGAGGAGAAATACTAGATGCAGTTCCATATTGATGACATGACCTGCGGCGGCTGCGCCAGTACGGTAAAAAAGACGATTCTGACTCTCGA TGCTAATGCGACGGTGAGAACTGACCCGGCGACGCGTCTGGTTGACGTTGAAACGTCGCTATCCGCGGAGCAGATTGCCGCCGCCCTGCAA AAGGCCGGTTTCCCGCCGCGCGAGACCTAATACTAGATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTA CTATGAACAGATTGGTCTGATTCCCGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTAT ACGCCGCGCGCGCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTCA AACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGCGCTGATTCACTG CTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGA
User Reviews
UNIQfbfc032f3156499c-partinfo-00000000-QINU
Stockholm 2015 |
This part is not the MicF target. |