Difference between revisions of "Part:BBa K310004:Experience"
(→‎Stockholm 2015 iGEM Team)
 
(7 intermediate revisions by the same user not shown)
Line 5: Line 5:
 
===Applications of BBa_K310004===
 
===Applications of BBa_K310004===
  
−
Stockholm 2015 iGEM Team
+
 
 +
 
 +
== Stockholm 2015 iGEM Team ==
 +
 
  
 
This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.
 
This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.
  
 
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.  
 
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.  
 +
 +
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
 +
 +
 +
'''Restriction analysis of BBa_K310004'''
  
 
[[File:K310004 restriction analysis Stockholm 2015.png|border|Restriction Analysis]]  
 
[[File:K310004 restriction analysis Stockholm 2015.png|border|Restriction Analysis]]  
  
−
'''Left''': restriction analysis gel of K310004 in pSB1C3.  
+
'''Left''': Restriction analysis gel of BBa_K310004 in pSB1C3.
−
'''Middle''': Simulated gel (SnapGene) with K310004 sequence provided by iGEM Team UIUC Illinois 2010.
+
−
'''Right''': Simulated gel (SnapGene) with sequence provided by iGEM Team Stockholm 2015
+
  
−
'''Well 2''': Positive control (134 bp).
+
'''Middle''': Gel simulated in SnapGene using BBa_K310004 sequence, provided by UIUC Illinois 2010 iGEM Team.  
−
'''Well 3''': K310004 in pSB1C3 digested with EcoRI.
+
−
'''Well 4''': K310004 in pSB1C3 digested with EcoR and PstI.
+
−
'''Well 5''': K310004 in pSB1C3 digested with EcoRI.
+
−
'''Well 6''': K310004 in pSB1C3 digested with EcoR and PstI.
+
  
−
We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
+
'''Right''': Gel simulated in SnapGene using BBa_K310004 sequence, provided by Stockholm 2015 iGEM Team.
 +
 
 +
 
 +
'''BBa_K310004 sequence contributed by Stockholm 2015'''
 +
 
 +
>BBa_K310004 Part-only sequence (684 bp)
 +
AAAGAGGAGAAATACTAGATGCAGTTCCATATTGATGACATGACCTGCGGCGGCTGCGCCAGTACGGTAAAAAAGACGATTCTGACTCTCGA
 +
TGCTAATGCGACGGTGAGAACTGACCCGGCGACGCGTCTGGTTGACGTTGAAACGTCGCTATCCGCGGAGCAGATTGCCGCCGCCCTGCAA
 +
AAGGCCGGTTTCCCGCCGCGCGAGACCTAATACTAGATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTA
 +
CTATGAACAGATTGGTCTGATTCCCGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTAT
 +
ACGCCGCGCGCGCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTCA
 +
AACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGCGCTGATTCACTG
 +
CTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGA
  
 
===User Reviews===
 
===User Reviews===
Line 31: Line 45:
 
|-
 
|-
 
|width='10%'|
 
|width='10%'|
−
<partinfo>BBa_K310004 AddReview 0 </partinfo>
+
<partinfo>BBa_J04450 AddReview number</partinfo>
−
<I>Stockholm 2015</I>
+
<I>Username</I>
 
|width='60%' valign='top'|
 
|width='60%' valign='top'|
−
This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.
+
Enter the review inofrmation here.
−
Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.  We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.
+
|};
−
|}
+
 
<!-- End of the user review template -->
 
<!-- End of the user review template -->
−
<!-- DON'T DELETE --><partinfo>BBa_K310004 EndReviews</partinfo>
+
{|width='80%' style='border:1px solid gray'
 +
|-
 +
|width='10%'|
 +
<partinfo>BBa_K310004 AddReview 0</partinfo>
 +
<I>Stockholm 2015</I>
 +
|width='60%' valign='top'|
 +
This part is not the MicF target.
 +
|};

Latest revision as of 21:03, 19 August 2015

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K310004

Stockholm 2015 iGEM Team

This part doesn’t work. The part is not the described MicF target, rather it appears to be a Cu-responsive transcriptional regulator from Salmonella enterica.

Restriction analysis with EcoRI and PstI shows an insert that is much larger than the expected 190 bp.

We therefore sequenced the part and found that it is a 684 bp BioBrick flanked by the BioBrick prefix and suffix. BLAST alignment of the part showed that it probably is a Cu-responsive transcriptional regulator from Salmonella enterica.


Restriction analysis of BBa_K310004

Restriction Analysis

Left: Restriction analysis gel of BBa_K310004 in pSB1C3.

Middle: Gel simulated in SnapGene using BBa_K310004 sequence, provided by UIUC Illinois 2010 iGEM Team.

Right: Gel simulated in SnapGene using BBa_K310004 sequence, provided by Stockholm 2015 iGEM Team.


BBa_K310004 sequence contributed by Stockholm 2015

>BBa_K310004 Part-only sequence (684 bp) AAAGAGGAGAAATACTAGATGCAGTTCCATATTGATGACATGACCTGCGGCGGCTGCGCCAGTACGGTAAAAAAGACGATTCTGACTCTCGA TGCTAATGCGACGGTGAGAACTGACCCGGCGACGCGTCTGGTTGACGTTGAAACGTCGCTATCCGCGGAGCAGATTGCCGCCGCCCTGCAA AAGGCCGGTTTCCCGCCGCGCGAGACCTAATACTAGATGAACATCGGTAAAGCAGCTAAAGCATCGAAAGTCTCGGCCAAAATGATTCGCTA CTATGAACAGATTGGTCTGATTCCCGCGGCAAGTCGGACGGATTCCGGCTATCGGGCCTATACCCAGGCTGATGTTAATCAATTGCATTTTAT ACGCCGCGCGCGCGACCTCGGTTTTTCAGTTGCTGAAATCAGCGACTTACTGAATCTTTGGAATAACCAGTCGCGGCAAAGCGCTGACGTCA AACGCCTGGCGCAGACGCACATTGATGAACTGGACAGACGTATCCAGAACATGCAGCACATGGCGCAAACCCTCAAAGCGCTGATTCACTG CTGCGCCGGCGACGCGCTGCCAGATTGCCCCATTCTGCATACGCTTGGA

User Reviews

UNIQfaace500cccf55bc-partinfo-00000000-QINU

Stockholm 2015

This part is not the MicF target.

;