Difference between revisions of "Part:BBa K1351022"
(→FsrA: a small RNA Represses Expression of Succinate Dehydrogenase) |
|||
(3 intermediate revisions by the same user not shown) | |||
Line 21: | Line 21: | ||
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus]. | This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus]. | ||
+ | ===FsrA: a small RNA Represses Expression of Succinate Dehydrogenase=== | ||
+ | |||
+ | Regulation of bacterial iron homeostasis is often controlled by the iron-sensing ferric uptake repressor (Fur). The ''Bacillus subtilis'' Fur protein acts as an iron-dependent repressor for siderophore biosynthesis and iron transport proteins. Furthermore it also coordinates an iron-sparing response that acts to repress the expression of iron-rich proteins (e.g. succinate dehydrogenase) when iron is limited. It has been shown that the downregulation of succinate dehydrogenase (SDH) is most likely caused by complementary binding of a small RNA, named fsrA, to the leader region of the sdhCAB mRNA, namely SdhC' (Fig. 1). | ||
+ | |||
+ | [[File:Background_Fig.5.png|thumb|600px|center|Fig. 1. Predicted pairing between fsrA and the 5’-leader region of sdhC, the first gene of the sdhCAB operon.]] | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Latest revision as of 18:58, 30 October 2014
FsrA: Fur-regulated sRNA which binds the binding site sdhC
This part was generated with the RFC10 standard and has the following prefix and suffix:
prefix with EcoRI, NotI and XbaI: | GAATTCGCGGCCGCTTCTAGAG |
suffix with SpeI, NotI and PstI: | TACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
FsrA: a small RNA Represses Expression of Succinate Dehydrogenase
Regulation of bacterial iron homeostasis is often controlled by the iron-sensing ferric uptake repressor (Fur). The Bacillus subtilis Fur protein acts as an iron-dependent repressor for siderophore biosynthesis and iron transport proteins. Furthermore it also coordinates an iron-sparing response that acts to repress the expression of iron-rich proteins (e.g. succinate dehydrogenase) when iron is limited. It has been shown that the downregulation of succinate dehydrogenase (SDH) is most likely caused by complementary binding of a small RNA, named fsrA, to the leader region of the sdhCAB mRNA, namely SdhC' (Fig. 1).
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]