Difference between revisions of "Part:BBa K1351017"

 
(5 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
<partinfo>BBa_K1351017 short</partinfo>
 
<partinfo>BBa_K1351017 short</partinfo>
  
This gene codes for the immunity against a cannibalism toxin SdpC of ''Bacillus subtilis''. The ''sdpI'' gene is regulated by a separate promoter (PsdpIR) which is responsible for the operon sdpIR. Cannibalsim toxins are produced by ''B. subtilis'' mainly in mid to late stationary phase when nutrients are limited.  
+
This gene codes for the immunity against the cannibalism toxin SDP of ''Bacillus subtilis''. The ''sdpI'' gene is regulated by a separate promoter (PsdpRI) which is responsible for the operon sdpRI. Cannibalsim toxins are produced by ''B. subtilis'' mainly in mid to late stationary phase when nutrients are limited.  
We wanted to evaluate the immunity in order to later on interferre with it for our module: [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus suicide].  
+
We wanted to evaluate the immunity in order to later on interfere with it for our [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus suicide module].  
For more details on our interference strategies please check our antisense mRNA [https://parts.igem.org/Part:BBa_K1351019 BBa_K1351019].  
+
For more details about our interference strategies please check our antisense RNA [https://parts.igem.org/Part:BBa_K1351019 BBa_K1351019] and our small RNA fsrA [https://parts.igem.org/Part:BBa_K1351022 BBa_K1351022].
  
 
<br><br>
 
<br><br>
Line 19: Line 19:
 
[[File:LMU14Sdpi.PNG|600px]]
 
[[File:LMU14Sdpi.PNG|600px]]
  
The graph shows grwoth curves of ''Bacillus subtilis'' wildtype, a ''SdpI'' deletion strain as well as a strain carrying our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351017 BBa_K1351017] in trans.  
+
The graph shows growth curves of ''Bacillus subtilis'' W168 wildtype, a ''sdpI'' mutant strain as well as a ''sdpI'' mutant strain carrying our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351017 BBa_K1351017].  
The results were performed with our protocoll: [https://static.igem.org/mediawiki/2014/c/c7/LMU-Munich14_Luminescence_Assay.pdf Lumi Assay] in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose.  
+
The results were performed with our protocoll: [https://static.igem.org/mediawiki/2014/c/c7/LMU-Munich14_Luminescence_Assay.pdf Lumi Assay] in MCSE and consist of three replicas of three measurements. The induction was performed with 0.2% xylose.  
These results clearly show that our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351017 BBa_K1351017] is functional and recovers wild type grwoth behavior.  
+
These results clearly show that our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351017 BBa_K1351017] is functional and recovers wild type growth behavior.  
 
<br><br>
 
<br><br>
  

Latest revision as of 15:58, 30 October 2014

SdpI with RBS: Immunity against the cannibalsim toxin sdpC of B. subtilis

This gene codes for the immunity against the cannibalism toxin SDP of Bacillus subtilis. The sdpI gene is regulated by a separate promoter (PsdpRI) which is responsible for the operon sdpRI. Cannibalsim toxins are produced by B. subtilis mainly in mid to late stationary phase when nutrients are limited. We wanted to evaluate the immunity in order to later on interfere with it for our [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus suicide module]. For more details about our interference strategies please check our antisense RNA BBa_K1351019 and our small RNA fsrA BBa_K1351022.



Prefix: TGCAGAATTCGCGGCCGCTTCTAGAGTAAGGAGGAACTACT
Suffix: TACTAGTAGCGGCCGCTGCAGGCT
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].



First results of this BioBrick are depicted in the following graph:

LMU14Sdpi.PNG

The graph shows growth curves of Bacillus subtilis W168 wildtype, a sdpI mutant strain as well as a sdpI mutant strain carrying our BioBrick BBa_K1351017. The results were performed with our protocoll: Lumi Assay in MCSE and consist of three replicas of three measurements. The induction was performed with 0.2% xylose. These results clearly show that our BioBrick BBa_K1351017 is functional and recovers wild type growth behavior.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]