Difference between revisions of "Part:BBa K1321333:Design"
(→References) |
|||
| (2 intermediate revisions by the same user not shown) | |||
| Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates. The primers used during this procedure were as follows: | The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates. The primers used during this procedure were as follows: | ||
| − | Forward: TACTAGTAGCGGCCGCTGCAG | + | <li>Forward: TACTAGTAGCGGCCGCTGCAG |
| − | Reverse: GCTAGCCCAAAAAAACGGGTATGGAG | + | <li>Reverse: GCTAGCCCAAAAAAACGGGTATGGAG |
| − | The resulting elements were DpnI-treated following a standard procedure and were submitted to self-ligation at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates. | + | <p>The resulting elements were DpnI-treated following a standard procedure and were submitted to self-ligation at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates. |
===Source=== | ===Source=== | ||
===References=== | ===References=== | ||
| − | https://parts.igem.org/Part:BBa_K325108 | + | <li>https://parts.igem.org/Part:BBa_K325108 |
| − | https://parts.igem.org/Part:BBa_K325218 | + | <li>https://parts.igem.org/Part:BBa_K325218 |
| − | https://parts.igem.org/Part:BBa_K325219 | + | <li>https://parts.igem.org/Part:BBa_K325219 |
Latest revision as of 17:05, 21 October 2014
pSB-AraC-pBAD
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 1205
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1144
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 979
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI site found at 961
Design Notes
The AraC and pBAD elements were obtained by PCR, using the Biobricks BBa_K325108, BBa_K325218 and BBa_K325219 as DNA templates. The primers used during this procedure were as follows:
The resulting elements were DpnI-treated following a standard procedure and were submitted to self-ligation at room temperature for 1h+. The ligation mix was then transformed into chemically competent DH10B Escherichia coli using a standard chemical transformation protocol and plated out on Chloramphenicol-specific LB plates.