Difference between revisions of "Part:BBa K1431824:Design"
(→Design Notes) |
(→Sequencing Results) |
||
Line 20: | Line 20: | ||
VR: attaccgcctttgagtgagc | VR: attaccgcctttgagtgagc | ||
− | The sequencing result is almost consistent with the sequence provided by Parts Registry except for a point mutation which doesn't influence essential part region or enzyme digestion site. | + | The sequencing result is almost consistent with the sequence provided by Parts Registry except for a point mutation which doesn't influence essential part region or enzyme digestion site.So it's a 'benign' mutation. |
===Source=== | ===Source=== |
Latest revision as of 03:52, 18 October 2014
amajLime, yellow-green chromoprotein reporter system (Weak Promoter, Weak RBS)
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
This Biobrick is constructed through 3 steps:
- Do double enzyme digestion (XbaI & PstI for BBa_K1033916, SpeI & PstI for BBa_B0031) and do gel extraction, ligation, transformation, picking up single colonies, LB broth incubation, plasmid extraction and gel electrophoresis verification.
- Do double enzyme digestion (XbaI & PstI for Step 1 product, SpeI & PstI for J23106) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
- Do double enzyme digestion (EcoRI-HF & SpeI for Step 2 product, EcoRI-HF & XbaI for B0015) and do gel extraction, ligation, transformation, picking up single colonies (can select the positive colonies from the colony color), LB broth incubation, plasmid extraction and gel electrophoresis verification.
- Cryopreserved the rest bacteria broth and send samples for sequencing.
Sequencing Results
We sent fresh bacteria broth for sequencing using standard Biobricks sequencing primer VF2/VR. The sequencing cooperation we used is Invitrogen Guangzhou filiale.
Sequence of sequencing primer we used:
VF2: tgccacctgacgtctaagaa
VR: attaccgcctttgagtgagc
The sequencing result is almost consistent with the sequence provided by Parts Registry except for a point mutation which doesn't influence essential part region or enzyme digestion site.So it's a 'benign' mutation.
Source
The following list is the Biobricks we've used in construction and their detailed design information.
Part | Type | Discription | Backbone | Location on the plate |
---|---|---|---|---|
BBa_J23100 | Promoter | Strong Promoter | BBa_J61002 (Amp) | 17D 2014 Kit Plate 4 |
BBa_J23106 | Promoter | Weak Promoter | BBa_J61002 (Amp) | 17P 2014 Kit Plate 4 |
BBa_B0031 | RBS | Weak RBS | pSB1A2 | 1H 2014 Kit Plate 4 |
BBa_B0034 | RBS | Strong RBS | pSB1A2 | 1N 2014 Kit Plate 4 |
BBa_B0015 | Terminator | Strong terminator (B0010+B0012) | pSB1C3 | 3F 2014 Kit Plate 3 |
BBa_K592009 | Chromoprotein | amilCP, blue chromoprotein | pSB1C3 | 19E 2014 Kit Plate 1 |
BBa_K592011 | Chromoprotein | cjBlue, green chromoprotein | pSB1C3 | 2I 2014 Kit Plate 4 |
BBa_K1033916 | Chromoprotein | amajLime, yellow-green chromoprote | pSB1C3 | 6M 2014 Kit Plate 4 |