Difference between revisions of "Part:BBa J31001:Design"

(→‎Design Notes)
(→‎Source)
 
(14 intermediate revisions by 3 users not shown)
Line 8: Line 8:
 
{| width="800px"
 
{| width="800px"
 
|- valign="top"  
 
|- valign="top"  
−
| colspan="3" | The Hin invertase enzyme from Salmonella typhimurium has been studied extensively in E. coli. We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system. As a dimer, Hin binds each Hix sequence flanking a fragment of DNA to be inverted. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004).
+
| colspan="3" | The Hin invertase enzyme from ''Salmonella typhimurium'' has been studied extensively in ''E. coli''. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.  
 
|- valign="top"
 
|- valign="top"
 
| colspan="3" | <small>'''Figure 1.''' 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)</small>
 
| colspan="3" | <small>'''Figure 1.''' 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)</small>
Line 18: Line 18:
  
 
===Design Notes===
 
===Design Notes===
 +
 +
This part was cloned via PCR amplification of <partinfo>BBa_J31000</partinfo> using the following primers. The reverse oligo was designed to add the <font color='darkgreen'>LVA degradation tag</font> to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.
 +
<br>Forward: 5' <b>TCTGGAATTCGCGGCCGCATCTAGAGATG</b>
 +
<br>Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTA<font color='darkgreen'>AGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font><b>ATTCATTCGTTTTTTTATAC</b>
  
 
The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.
 
The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.
Line 30: Line 34:
 
'''Prefix'''<br>There is <font color='red'>no T spacer (*)</font> between the NotI site and the XbaI site.<br>There is <font color='blue'>no G spacer (*)</font> between the XbaI and the Hin coding region.<br>
 
'''Prefix'''<br>There is <font color='red'>no T spacer (*)</font> between the NotI site and the XbaI site.<br>There is <font color='blue'>no G spacer (*)</font> between the XbaI and the Hin coding region.<br>
 
'''Suffix'''<br>There is <font color='purple'>no T spacer (*)</font> between the Hin coding region and the SpeI site.<br>The A spacer between the SpeI and the NotI has changed to a <font color='darkgreen'>T</font>.<br>There is an extra <font color='magenta'>C</font> between the NotI site and the PstI site
 
'''Suffix'''<br>There is <font color='purple'>no T spacer (*)</font> between the Hin coding region and the SpeI site.<br>The A spacer between the SpeI and the NotI has changed to a <font color='darkgreen'>T</font>.<br>There is an extra <font color='magenta'>C</font> between the NotI site and the PstI site
−
|}
 
−
 
−
===Data===
 
−
 
−
{| width="800px"
 
−
|-
 
−
| colspan="3" | '''Inversion of HixC-flanked DNA in the presence of HinLVA'''<br>HinLVA has been assembled with a pLac promoter and RBS (see <partinfo>BBa_S03536</partinfo>) to create a HinLVA expression casette. We observe inversion of HixC-flanked segments of DNA in the presence of this casette. Figure 2 shows the sizes of predicted NheI restriction fragments for different confirmations of two HixC-flanked DNA segments. A construct carrying the pBad promoter in the forward orientation (<partinfo>BBa_S03564</partinfo>) yields a 200 bp fragment (Figure 3, lane 2), while the reverse orientation (<partinfo>BBa_S03565</partinfo>) yields a larger 300 bp fragment (Figure 3, lane 3). In the presence of the HinLVA expression casette, the construct carrying pBad in the forward orientation shows restriction fragments for both orientations (Figure 3, lane 4). Similar results are seen for a construct carrying a HixC-flanked RBS-Tet segment (<partinfo>BBa_J3103</partinfo>) (Figure 4). The occurrence of the forward and reverse orientations in roughly equal proportions suggests that inversion has reached a steady state. Inversion occurs without IPTG induction of pLac-Hin. This may be caused by Hin expression via read-through from the vector backbone or leaky transcription from pLac.
 
−
|-
 
−
| [[Image:NheI_map.gif|thumb|400px|'''Figure 2.''' Predicted NheI fragments for different conformations of the different HixC-flanked DNA fragments tested (not drawn to scale).]]
 
−
| [[Image:PBad_flipping.jpg|thumb|200px|'''Figure 3.''' An NheI digest detects Hin-mediated flipping of a HixC-flanked pBad promoter.]]
 
−
| [[Image:Tet_flipping.jpg|thumb|200px|'''Figure 4.''' An NheI digest detects Hin-mediated flipping of a HixC-flanked coding region (RBS-Tet).]]
 
 
|}
 
|}
  
 
===Source===
 
===Source===
  
−
Hin invertase (<partinfo>BBa_J31000</partinfo>) from Salmonella typhimurium and the LVA degredation tag (<partinfo>BBa_M0040</partinfo>).
+
1. Hin invertase (<partinfo>BBa_J31000</partinfo>) from Salmonella typhimurium <br>
 +
2. The 11 amino acid "gfp(down,LVA)" ssrA degradation tag (Andersen et al., Appl Environ Microbiol, 1998).
  
 
===References===
 
===References===
 +
* Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) ''An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA''. PNAS.
 
* Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) ''Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs''. Science. 309: 1210-1215
 
* Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) ''Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs''. Science. 309: 1210-1215
 
* Sanders, E.R., Johnson, R.C. (2004) ''Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution''. J. Mol. Biol. 340: 753–766.
 
* Sanders, E.R., Johnson, R.C. (2004) ''Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution''. J. Mol. Biol. 340: 753–766.
−
* [https://dspace.mit.edu/handle/1721.1/21168| Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks]
+
* [https://dspace.mit.edu/handle/1721.1/21168/ Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks]
−
* '''Figure 3.''' The data in Figure 3 was generously provided by Todd Eckdahl (Missouri Western State University iGEM 2006 Team).
+
* Yang, W., Steitz, T.A. (1995) ''Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site''. Cell. 82:193-207

Latest revision as of 16:11, 1 April 2008

DNA invertase Hin tagged with LVA


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Hin Invertase

The Hin invertase enzyme from Salmonella typhimurium has been studied extensively in E. coli. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.
Figure 1. 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)
A Hin protein dimer bound to DNA at a Hix site (PDB 1GDT, Yang and Steitz 1995). View the [http://www.rcsb.org/pdb/explore.do?structureId=1GDT interactive 3-D Jmol image].
A Hin protein dimer bound to cleaved DNA (PDB 2GM4, Kamtekar et al. 2006). View the [http://www.rcsb.org/pdb/explore.do?structureId=2GM4 interactive 3-D Jmol image].
A Hin terad complex poised to swap DNA ends for inversion and ligation (PDB 1ZR4, Li et al. 2005). View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].

Design Notes

This part was cloned via PCR amplification of BBa_J31000 using the following primers. The reverse oligo was designed to add the LVA degradation tag to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.
Forward: 5' TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC

The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.

Standard BioBrick Cloning Sites (Knight) 5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG--
3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC--
BBa_J31001 Cloning Sites 5'--GAATTC GCGGCCGC * TCTAGA * --Hin coding-- * ACTAGT T GCGGCCGCCTGCAG--
3'--CTTAAG CGCCGGCG * AGATCT * -------------- * TGATCA A CGCCGGCGGACGTC--

Prefix
There is no T spacer (*) between the NotI site and the XbaI site.
There is no G spacer (*) between the XbaI and the Hin coding region.
Suffix
There is no T spacer (*) between the Hin coding region and the SpeI site.
The A spacer between the SpeI and the NotI has changed to a T.
There is an extra C between the NotI site and the PstI site

Source

1. Hin invertase (BBa_J31000) from Salmonella typhimurium
2. The 11 amino acid "gfp(down,LVA)" ssrA degradation tag (Andersen et al., Appl Environ Microbiol, 1998).

References

  • Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA. PNAS.
  • Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs. Science. 309: 1210-1215
  • Sanders, E.R., Johnson, R.C. (2004) Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution. J. Mol. Biol. 340: 753–766.
  • Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks
  • Yang, W., Steitz, T.A. (1995) Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site. Cell. 82:193-207