Difference between revisions of "Part:BBa K1351014"
 
(3 intermediate revisions by one other user not shown)
Line 7: Line 7:
 
<b>Immunity</b>
 
<b>Immunity</b>
  
−
[[File:LMU14 killing subtilin Immunity assay.png|thumb|600px|center|Fig. 1. Supernatant-in-lawn assay shows smaller halo diameters for ''B. subtilis'' with BioBRick-acquired immunity. ]]
+
[[File:LMU14_killing_subtilin_Immunity_assay.png|thumb|600px|center|Fig. 1. Supernatant-in-lawn assay shows smaller halo diameters for ''B. subtilis'' with BioBRick-acquired immunity.]]
 
The part was evaluated with a variation of an spot-on-lawn assay. In this case, holes were cut out of agar plates on which either ''B. subtilis'' W168 wild type or ''B. subtilis'' W168 ''amyE''::P<sub>''xyl''</sub>_''spaIFEG'' were plated. The holes were then filled with different amounts of sterile supernatant from overnight cultures of W168 or ATCC6633, respectively. The xylose-containing plates were incubated at 37 °C for 24 h and resulting halo diameters were measured. The supernatant derived from the negative control (W168) did not cause any growth inhibition to neither the wild type, nor to the strain who carries the immunity BioBrick (Figure XY). The subtilin-containing supernatant from ''B. subtilis'' ATCC6633 however, was able to inhibit the growth of both bacterial lawns. For the lowest amounts (32 µl), no significant difference between the halo diameters could be determined. The larger the amount of supernatant, and presumably, the higher the amount of subtilin in there, the bigger the zones of inhibition. For the largest volume (128 µl), a two-sided T-test could determine the p-value below 0.1 (p=0,007762603) and by this prove the functionality of this BioBrick. This is a major step for this project, as the immunity is the base for any strain which produces antimicrobial peptides. Now further steps can be taken and the remaining BioBricks can be evaluated.
 
The part was evaluated with a variation of an spot-on-lawn assay. In this case, holes were cut out of agar plates on which either ''B. subtilis'' W168 wild type or ''B. subtilis'' W168 ''amyE''::P<sub>''xyl''</sub>_''spaIFEG'' were plated. The holes were then filled with different amounts of sterile supernatant from overnight cultures of W168 or ATCC6633, respectively. The xylose-containing plates were incubated at 37 °C for 24 h and resulting halo diameters were measured. The supernatant derived from the negative control (W168) did not cause any growth inhibition to neither the wild type, nor to the strain who carries the immunity BioBrick (Figure XY). The subtilin-containing supernatant from ''B. subtilis'' ATCC6633 however, was able to inhibit the growth of both bacterial lawns. For the lowest amounts (32 µl), no significant difference between the halo diameters could be determined. The larger the amount of supernatant, and presumably, the higher the amount of subtilin in there, the bigger the zones of inhibition. For the largest volume (128 µl), a two-sided T-test could determine the p-value below 0.1 (p=0,007762603) and by this prove the functionality of this BioBrick. This is a major step for this project, as the immunity is the base for any strain which produces antimicrobial peptides. Now further steps can be taken and the remaining BioBricks can be evaluated.
  
  
  
−
[[File:LMU14 killing-subtilin supernatant-in-lawn.png|thumb|500px|center|Fig. 1..]]
+
[[File:LMU14 killing-subtilin supernatant-in-lawn.png|thumb|500px|center|Fig. 1 Evaluation of the spaIFEG BioBrick]]
  
 
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:  
 
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:  

Latest revision as of 16:55, 29 October 2014

spaIFEG Subtilin (Immunity)

spaIFEG are coding for immunity to the antibiotic subtilin in Bacillus subtilis ATCC6633. spaI: Lipoprotein, spaFEG: ABC-Transporter

Immunity

Fig. 1. Supernatant-in-lawn assay shows smaller halo diameters for B. subtilis with BioBRick-acquired immunity.

The part was evaluated with a variation of an spot-on-lawn assay. In this case, holes were cut out of agar plates on which either B. subtilis W168 wild type or B. subtilis W168 amyE::Pxyl_spaIFEG were plated. The holes were then filled with different amounts of sterile supernatant from overnight cultures of W168 or ATCC6633, respectively. The xylose-containing plates were incubated at 37 °C for 24 h and resulting halo diameters were measured. The supernatant derived from the negative control (W168) did not cause any growth inhibition to neither the wild type, nor to the strain who carries the immunity BioBrick (Figure XY). The subtilin-containing supernatant from B. subtilis ATCC6633 however, was able to inhibit the growth of both bacterial lawns. For the lowest amounts (32 µl), no significant difference between the halo diameters could be determined. The larger the amount of supernatant, and presumably, the higher the amount of subtilin in there, the bigger the zones of inhibition. For the largest volume (128 µl), a two-sided T-test could determine the p-value below 0.1 (p=0,007762603) and by this prove the functionality of this BioBrick. This is a major step for this project, as the immunity is the base for any strain which produces antimicrobial peptides. Now further steps can be taken and the remaining BioBricks can be evaluated.


Fig. 1 Evaluation of the spaIFEG BioBrick

This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI: ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 722
    Illegal BglII site found at 1470
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1737
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1017
    Illegal SapI site found at 1297
    Illegal SapI.rc site found at 2020