Difference between revisions of "Part:BBa J31001:Design"
(→‎Source)
 
(27 intermediate revisions by 3 users not shown)
Line 7: Line 7:
 
===Hin Invertase===
 
===Hin Invertase===
 
{| width="800px"
 
{| width="800px"
 +
|- valign="top"
 +
| colspan="3" | The Hin invertase enzyme from ''Salmonella typhimurium'' has been studied extensively in ''E. coli''. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.
 
|- valign="top"
 
|- valign="top"
−
| [[Image:Jmol_Hin_tetrad_DNA.gif|thumb|250px|'''Figure 1.''' 3-D structure of a Hin protein complex bound to DNA. View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].]]
+
| colspan="3" | <small>'''Figure 1.''' 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)</small>
−
| To the left is a 3-D model of the a Hin/ DNA complex crystal structure (Protein Data Bank ID 1ZR4, Li et al. 2005). A Hin protein dimer binds each HixC sequence flanking the fragment of DNA to be inverted. The two dimers (dimer 1 = leftward green and blue protein structures; dimer 2 = rightward yellow and purple protein structures) come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004).
+
|- valign="top"
 +
| [[Image:Hin_dimer_closed_1GDT.gif|thumb|200px| A Hin protein dimer bound to DNA at a Hix site (PDB 1GDT, Yang and Steitz 1995). View the [http://www.rcsb.org/pdb/explore.do?structureId=1GDT interactive 3-D Jmol image].]]
 +
| [[Image:Hin_dimer_cut_2GM4.gif|thumb|200px| A Hin protein dimer bound to cleaved DNA (PDB 2GM4, Kamtekar et al. 2006). View the [http://www.rcsb.org/pdb/explore.do?structureId=2GM4 interactive 3-D Jmol image].]]
 +
| [[Image:Jmol_Hin_tetrad_DNA.gif|thumb|200px| A Hin terad complex poised to swap DNA ends for inversion and ligation (PDB 1ZR4, Li et al. 2005). View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].]]
 
|}
 
|}
  
 
===Design Notes===
 
===Design Notes===
−
This part is cloned in plasmid pSB1A2.
 
  
−
The Biobricks on this part are not wildtype but the cut sites are still viable.
+
This part was cloned via PCR amplification of <partinfo>BBa_J31000</partinfo> using the following primers. The reverse oligo was designed to add the <font color='darkgreen'>LVA degradation tag</font> to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.  
 +
<br>Forward: 5' <b>TCTGGAATTCGCGGCCGCATCTAGAGATG</b>
 +
<br>Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTA<font color='darkgreen'>AGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font><b>ATTCATTCGTTTTTTTATAC</b>
  
−
{| width="850px" cellspacing="2"
+
The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.
 +
 
 +
{| width="800px" cellspacing="5"
 
|- valign="top"
 
|- valign="top"
−
| style="width:200px" | '''Standard BioBrick Cloning Sites''' (Knight)
+
| style="width:180px" | '''Standard BioBrick Cloning Sites''' (Knight)
 
| style="background:lightgrey"|<font face="courier">5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG--<br>3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC--</font>
 
| style="background:lightgrey"|<font face="courier">5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG--<br>3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC--</font>
 
|- valign="top"
 
|- valign="top"
−
| style="width:200px" | '''BBa_J31001 Cloning Sites'''  
+
| style="width:180px" | '''BBa_J31001 Cloning Sites'''  
−
| style="background:lightgrey" |<font face="courier">5'--GAATTC GCGGCCGC <font color='red'>*</font> TCTAGA <font color='blue'>*</font> --Hin coding-- <font color='purple'>*</font> ACTAGT <font color='darkgreen'>T</font> GCGGCCG<font color='magenta'>C</font>CTGCAG--</font><br><br>
+
| style="background:lightgrey" |<font face="courier">5'--GAATTC GCGGCCGC <font color='red'>*</font> TCTAGA <font color='blue'>*</font> --Hin coding-- <font color='purple'>*</font> ACTAGT <font color='darkgreen'>T</font> GCGGCCG<font color='magenta'>C</font>CTGCAG--<br>3'--CTTAAG CGCCGGCG <font color='red'>*</font> AGATCT <font color='blue'>*</font> -------------- <font color='purple'>*</font> TGATCA <font color='darkgreen'>A</font> CGCCGGC<font color='magenta'>G</font>GACGTC--</font><br><br>
 
'''Prefix'''<br>There is <font color='red'>no T spacer (*)</font> between the NotI site and the XbaI site.<br>There is <font color='blue'>no G spacer (*)</font> between the XbaI and the Hin coding region.<br>
 
'''Prefix'''<br>There is <font color='red'>no T spacer (*)</font> between the NotI site and the XbaI site.<br>There is <font color='blue'>no G spacer (*)</font> between the XbaI and the Hin coding region.<br>
−
'''Suffix'''<br>There is no <font color='purple'>T spacer</font> between the Hin coding region and the SpeI site.<br>The A spacer between the SpeI and the NotI has changed to a <font color='darkgreen'>T</font>.<br>There is an extra <font color='magenta'>C</font> between the NotI site and the PstI site
+
'''Suffix'''<br>There is <font color='purple'>no T spacer (*)</font> between the Hin coding region and the SpeI site.<br>The A spacer between the SpeI and the NotI has changed to a <font color='darkgreen'>T</font>.<br>There is an extra <font color='magenta'>C</font> between the NotI site and the PstI site
−
|}
+
−
 
+
−
===Data===
+
−
 
+
−
HinLVA has been assembled with a pLac promoter and RBS (see <partinfo>BBa_S03536</partinfo>) to create a HinLVA expression casette. We observe inversion of HixC-flanked segments of DNA in the presence of this casette. Inversion occurs without IPTG induction of pLac-Hin. This may be caused by read-through from the vector backbone or leaky transcription from pLac.
+
−
 
+
−
{|
+
−
|-
+
−
| [[Image:PBad_flipping.jpg|thumb|250px|'''Figure 2.''' An NheI digest detects Hin-mediated flipping of a HixC-flanked pBad promoter.]]
+
−
| [[Image:Tet_flipping.jpg|thumb|250px|'''Figure 3.''' An NheI digest detects Hin-mediated flipping of a HixC-flanked coding region (RBS-Tet).]]
+
 
|}
 
|}
  
 
===Source===
 
===Source===
  
−
Hin invertase (<partinfo>BBa_J31000</partinfo>) from Salmonella typhimurium and the LVA degredation tag (<partinfo>BBa_M0040</partinfo>).
+
1. Hin invertase (<partinfo>BBa_J31000</partinfo>) from Salmonella typhimurium <br>
 +
2. The 11 amino acid "gfp(down,LVA)" ssrA degradation tag (Andersen et al., Appl Environ Microbiol, 1998).
  
 
===References===
 
===References===
 +
* Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) ''An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA''. PNAS.
 
* Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) ''Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs''. Science. 309: 1210-1215
 
* Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) ''Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs''. Science. 309: 1210-1215
 
* Sanders, E.R., Johnson, R.C. (2004) ''Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution''. J. Mol. Biol. 340: 753–766.
 
* Sanders, E.R., Johnson, R.C. (2004) ''Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution''. J. Mol. Biol. 340: 753–766.
−
* [https://dspace.mit.edu/handle/1721.1/21168| Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks]
+
* [https://dspace.mit.edu/handle/1721.1/21168/ Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks]
 +
* Yang, W., Steitz, T.A. (1995) ''Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site''. Cell. 82:193-207

Latest revision as of 16:11, 1 April 2008

DNA invertase Hin tagged with LVA


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Hin Invertase

The Hin invertase enzyme from Salmonella typhimurium has been studied extensively in E. coli. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.
Figure 1. 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)
A Hin protein dimer bound to DNA at a Hix site (PDB 1GDT, Yang and Steitz 1995). View the [http://www.rcsb.org/pdb/explore.do?structureId=1GDT interactive 3-D Jmol image].
A Hin protein dimer bound to cleaved DNA (PDB 2GM4, Kamtekar et al. 2006). View the [http://www.rcsb.org/pdb/explore.do?structureId=2GM4 interactive 3-D Jmol image].
A Hin terad complex poised to swap DNA ends for inversion and ligation (PDB 1ZR4, Li et al. 2005). View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].

Design Notes

This part was cloned via PCR amplification of BBa_J31000 using the following primers. The reverse oligo was designed to add the LVA degradation tag to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.
Forward: 5' TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC

The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.

Standard BioBrick Cloning Sites (Knight) 5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG--
3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC--
BBa_J31001 Cloning Sites 5'--GAATTC GCGGCCGC * TCTAGA * --Hin coding-- * ACTAGT T GCGGCCGCCTGCAG--
3'--CTTAAG CGCCGGCG * AGATCT * -------------- * TGATCA A CGCCGGCGGACGTC--

Prefix
There is no T spacer (*) between the NotI site and the XbaI site.
There is no G spacer (*) between the XbaI and the Hin coding region.
Suffix
There is no T spacer (*) between the Hin coding region and the SpeI site.
The A spacer between the SpeI and the NotI has changed to a T.
There is an extra C between the NotI site and the PstI site

Source

1. Hin invertase (BBa_J31000) from Salmonella typhimurium
2. The 11 amino acid "gfp(down,LVA)" ssrA degradation tag (Andersen et al., Appl Environ Microbiol, 1998).

References

  • Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA. PNAS.
  • Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs. Science. 309: 1210-1215
  • Sanders, E.R., Johnson, R.C. (2004) Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution. J. Mol. Biol. 340: 753–766.
  • Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks
  • Yang, W., Steitz, T.A. (1995) Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site. Cell. 82:193-207