Difference between revisions of "Part:BBa J31001:Design"

(Data)
(Source)
 
(38 intermediate revisions by 3 users not shown)
Line 5: Line 5:
  
  
===Design Notes===
+
===Hin Invertase===
This part is cloned in plasmid pSB1A2.
+
{| width="800px"
 
+
|- valign="top"
The Biobricks on this part are not wildtype but the cut sites are still viable.
+
| colspan="3" | The Hin invertase enzyme from ''Salmonella typhimurium'' has been studied extensively in ''E. coli''. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.  
 
+
{| cellspacing="2"
+
 
|- valign="top"
 
|- valign="top"
| style="width:300px" | '''BioBrick Prefix'''<br>There is no <font color='red'>T spacer</font color> between the<font color='brown'> NotI site</font color> and the <font color='purple'>XbaI site</font color>. There is no <font color='lime'>G spacer</font color> between the <font color='purple'>XbaI</font> and the <u>coding region</u>.
+
| colspan="3" | <small>'''Figure 1.''' 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)</small>
| style="background:lightgrey" | <font face="courier"><font color='blue'>GAATTC</font><font color='brown'>GCGGCCGC</font><font color='red'>-</font><font color='purple'>TCTAGA</font><font color='lime'>-</font></font>
+
 
|- valign="top"
 
|- valign="top"
| style="width:300px" | '''Hin coding'''
+
| [[Image:Hin_dimer_closed_1GDT.gif|thumb|200px| A Hin protein dimer bound to DNA at a Hix site (PDB 1GDT, Yang and Steitz 1995). View the [http://www.rcsb.org/pdb/explore.do?structureId=1GDT interactive 3-D Jmol image].]]
| style="background:lightgrey" | <font face="courier"><u>TGGCTACTATTGGGTATATTCGGGTGTCAACAATTGACCAAAATATCGAT<br>
+
| [[Image:Hin_dimer_cut_2GM4.gif|thumb|200px| A Hin protein dimer bound to cleaved DNA (PDB 2GM4, Kamtekar et al. 2006). View the [http://www.rcsb.org/pdb/explore.do?structureId=2GM4 interactive 3-D Jmol image].]]
TTACAGCGTAATGCGCTTACCAGTGCAAATTGTGACCGCATTTTTGAGGA<br>
+
| [[Image:Jmol_Hin_tetrad_DNA.gif|thumb|200px| A Hin terad complex poised to swap DNA ends for inversion and ligation (PDB 1ZR4, Li et al. 2005). View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].]]
CCGTATCAGTGGCAAGATTGCAAACCGCCCCGGCCTGAAACGAGCGTTAA<br>
+
AGTATGTAAATAAAGGCGATACTCTTGTCGTCTGGAAATTAGACAGACTG<br>
+
GGCCGCAGCGTGAAAAACCTGGTGGCGTTAATATCAGAATTACATGAACG<br>
+
TGGAGCTCACTTCCATTCTTTAACCGATAGTATTGATACCAGTAGCGCGA<br>
+
TGGGGCGATTCTTTTTTCATGTAATGTCAGCACTGGCCGAGATGGAGCGA<br>
+
GAATTAATTGTCGAGCGAACCCTTGCCGGACTGGCTGCCGCCAGAGCGCA<br>
+
AGGACGACTGGGAGGGCGCCCTCGGGCGATCAACAGACATGAACAGGAAC<br>
+
AGATTAGTCGGCTATTAGAGAAAGGCCATCCTCGGCAGCAACTAGCTATT<br>
+
ATTTTTGGTATTGGCGTATCTACCTTATACAGATATTTTCCGGCAAGCCG<br>
+
TATAAAAAAACGAATGAATAGGCCTGCTGCAAACGACGAAAACTACGCTT<br>
+
TAGTAGCTTA</u></font>
+
|- valign="top"
+
| style="width:300px" | '''BioBrick Suffix''': There is no <font color='tan'>T spacer</font color> between the <u>insert</u> and the <font color='green'>SpeI site</font color>. The <font color='gold'>T spacer</font color> between the <font color='green'>SpeI</font color> and the <font color='magenta'>NotI</font color> sites should be an A. The last ''C'' of the <font color='magenta'>NotI</font color> site is not conserved with the initial C from the <font color='cyan'>PstI site</font color>. The BB suffix currently has this sequence for the <font color='magenta'>NotI</font color> and <font color='cyan'>PstI</font color> sites <font color='magenta'>GCGGCCGc</font color><font color='cyan'>CTGCAG</font color> But it should have been: <font color='magenta'>GCGGCCG</font color><font color='purple'>''C''</font color><font color='cyan'>TGCAG</font color>
+
| style="background:lightgrey" | <font face="courier"><font color='tan'>-</font><font color='green'>ACTAGT</font><font color='gold'>T</font><font color='magenta'>GCGGCCGC</font>''C''<font color='cyan'>TGCAG</font></font>
+
 
|}
 
|}
  
We compared our BioBricks with those from Tom Knight's paper,<u> Idempotent Vector Design for Standard Assembly of Biobricks</u>. As seen below
+
===Design Notes===
  
[[Image:BioBricks_from_paper.png]]
+
This part was cloned via PCR amplification of <partinfo>BBa_J31000</partinfo> using the following primers. The reverse oligo was designed to add the <font color='darkgreen'>LVA degradation tag</font> to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.
 +
<br>Forward: 5' <b>TCTGGAATTCGCGGCCGCATCTAGAGATG</b>
 +
<br>Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTA<font color='darkgreen'>AGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGC</font><b>ATTCATTCGTTTTTTTATAC</b>
  
===Data===
+
The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.
  
HinLVA has been assembled with a pLac promoter and RBS (see <partinfo>BBa_S03536</partinfo>) to create a HinLVA expression casette. We observe inversion of HixC-flanked segments of DNA in the presence of this casette. Inversion occurs with induction of Hin expression. This may be caused by read-through from the vector backbone or leaky transcription from pLac.
+
{| width="800px" cellspacing="5"
 
+
|- valign="top"
{|
+
| style="width:180px" | '''Standard BioBrick Cloning Sites''' (Knight)
|-
+
| style="background:lightgrey"|<font face="courier">5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG--<br>3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC--</font>
| [[Image:Jmol_Hin_tetrad_DNA.gif|thumb|250px|3-D structure of a Hin protein complex bound to DNA. View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].]]
+
|- valign="top"
| next image
+
| style="width:180px" | '''BBa_J31001 Cloning Sites'''
| next image
+
| style="background:lightgrey" |<font face="courier">5'--GAATTC GCGGCCGC <font color='red'>*</font> TCTAGA <font color='blue'>*</font> --Hin coding-- <font color='purple'>*</font> ACTAGT <font color='darkgreen'>T</font> GCGGCCG<font color='magenta'>C</font>CTGCAG--<br>3'--CTTAAG CGCCGGCG <font color='red'>*</font> AGATCT <font color='blue'>*</font> -------------- <font color='purple'>*</font> TGATCA <font color='darkgreen'>A</font> CGCCGGC<font color='magenta'>G</font>GACGTC--</font><br><br>
 +
'''Prefix'''<br>There is <font color='red'>no T spacer (*)</font> between the NotI site and the XbaI site.<br>There is <font color='blue'>no G spacer (*)</font> between the XbaI and the Hin coding region.<br>
 +
'''Suffix'''<br>There is <font color='purple'>no T spacer (*)</font> between the Hin coding region and the SpeI site.<br>The A spacer between the SpeI and the NotI has changed to a <font color='darkgreen'>T</font>.<br>There is an extra <font color='magenta'>C</font> between the NotI site and the PstI site
 
|}
 
|}
  
 
===Source===
 
===Source===
  
Salmonella typhimurium and the the Hin part without LVA.
+
1. Hin invertase (<partinfo>BBa_J31000</partinfo>) from Salmonella typhimurium <br>
 +
2. The 11 amino acid "gfp(down,LVA)" ssrA degradation tag (Andersen et al., Appl Environ Microbiol, 1998).
  
 
===References===
 
===References===
[https://dspace.mit.edu/handle/1721.1/21168| Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks]
+
* Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) ''An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA''. PNAS.
 +
* Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) ''Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs''. Science. 309: 1210-1215
 +
* Sanders, E.R., Johnson, R.C. (2004) ''Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution''. J. Mol. Biol. 340: 753–766.
 +
* [https://dspace.mit.edu/handle/1721.1/21168/ Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks]
 +
* Yang, W., Steitz, T.A. (1995) ''Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site''. Cell. 82:193-207

Latest revision as of 16:11, 1 April 2008

DNA invertase Hin tagged with LVA


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Hin Invertase

The Hin invertase enzyme from Salmonella typhimurium has been studied extensively in E. coli. Hin binds each Hix sequence flanking a fragment of DNA to be inverted as a dimer. The two dimers come together to form a tetrad complex where cleaved DNA ends are swapped and ligated (Richards and Johnson 2004). We have reconstituted the Hin invertase system (Hin coding region, Hix sites and a Recombination Enhancer DNA sequence) as a BioBrick compatible system.
Figure 1. 3-D models of Hin/ DNA complexes based upon crystal structure data (Yang and Steitz 1995, Li et al. 2005, Kamtekar et al. 2006)
A Hin protein dimer bound to DNA at a Hix site (PDB 1GDT, Yang and Steitz 1995). View the [http://www.rcsb.org/pdb/explore.do?structureId=1GDT interactive 3-D Jmol image].
A Hin protein dimer bound to cleaved DNA (PDB 2GM4, Kamtekar et al. 2006). View the [http://www.rcsb.org/pdb/explore.do?structureId=2GM4 interactive 3-D Jmol image].
A Hin terad complex poised to swap DNA ends for inversion and ligation (PDB 1ZR4, Li et al. 2005). View the [http://www.rcsb.org/pdb/explore/explore.do?structureId=1ZR4 interactive 3-D Jmol image].

Design Notes

This part was cloned via PCR amplification of BBa_J31000 using the following primers. The reverse oligo was designed to add the LVA degradation tag to the end of the Hin invertase coding region. Primer annealing sites are shown in bold.
Forward: 5' TCTGGAATTCGCGGCCGCATCTAGAGATG
Reverse: 5' ATGCCTGCAGGCGGCCGCAACTAGTTAAGCTACTAAAGCGTAGTTTTCGTCGTTTGCAGCATTCATTCGTTTTTTTATAC

The BioBrick prefix and suffix on this part are not wildtype but the restriction sites are still viable.

Standard BioBrick Cloning Sites (Knight) 5'--GAATTC GCGGCCGC T TCTAGA G ----insert---- T ACTAGT A GCGGCCG CTGCAG--
3'--CTTAAG CGCCGGCG A AGATCT C -------------- A TGATCA T CGCCGGC GACGTC--
BBa_J31001 Cloning Sites 5'--GAATTC GCGGCCGC * TCTAGA * --Hin coding-- * ACTAGT T GCGGCCGCCTGCAG--
3'--CTTAAG CGCCGGCG * AGATCT * -------------- * TGATCA A CGCCGGCGGACGTC--


Prefix
There is no T spacer (*) between the NotI site and the XbaI site.
There is no G spacer (*) between the XbaI and the Hin coding region.
Suffix
There is no T spacer (*) between the Hin coding region and the SpeI site.
The A spacer between the SpeI and the NotI has changed to a T.
There is an extra C between the NotI site and the PstI site

Source

1. Hin invertase (BBa_J31000) from Salmonella typhimurium
2. The 11 amino acid "gfp(down,LVA)" ssrA degradation tag (Andersen et al., Appl Environ Microbiol, 1998).

References

  • Kamtekar, S., Ho, R.S., Cocco, M.J., Li, W., Wenwieser, S.V.C.T., Boocock, M.R., Grindley, N.D.F., Steitz, T.A. (2006) An activated, tetrameric gamma-delta resolvase: Hin chimaera bound to cleaved DNA. PNAS.
  • Li, W., Kamtekar, S., Xiong, Y., Sarkis, G.J., Grindley, N.D., Steitz, T.A. (2005) Structure of a synaptic gamma delta resolvase tetramer covalently linked to two cleaved DNAs. Science. 309: 1210-1215
  • Sanders, E.R., Johnson, R.C. (2004) Stepwise Dissection of the Hin-catalyzed Recombination Reaction from Synapsis to Resolution. J. Mol. Biol. 340: 753–766.
  • Knight, Tom. Idempotent Vector Design for Standard Assembly of Biobricks
  • Yang, W., Steitz, T.A. (1995) Crystal structure of the site-specific recombinase gamma delta resolvase complexed with a 34 bp cleavage site. Cell. 82:193-207