Difference between revisions of "Part:BBa K1351016"

Latest revision as of 18:34, 31 October 2014

comDE Quorum Sensing two component system (Freiburg Standard)

Quorum sensing two component system (histidine kinase comD, response regulator comE) of Streptococcus pneumoniae (R6) able to sense the competence stimulating peptide CSP.

CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351024, BBa_K1351025 are BioBricks containing CEbs form different promoters of S. pneumoniae.

ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]

This part contains optimized RBS for Bacillus subtilis (in contrast to BBa_K1351015 were the native RBS was maintained) and was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV:	GAATTCCGCGGCCGCTTCTAGATAAGGAGGAGCCGGC
suffix with AgeI, SpeI, NotI and PstI:	ACCGGTTAATACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

First results of this BioBrick are depicted in the following bar chart:

Luminescence of B. subtilis P_xyl - comDE P_comC was measured in MCSE inducing 0.02 % xylose and different CSP concentrations (0 mg/ml, 100 mg/ml and 1000 mg/ml). This bar chart represents the luminescence output two hours after inducing with CSP. Induction of P_comC with 1000 mg/ml CSP showed a 3 fold increased luminescence output compared with an induction of 0 mg/ml and 100 mg/ml CSP.

In the following graph, a dose response curve of the two CSP inducible promoters P_comC and P_comAB is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.

Again, luminescence of B. subtilis P_xyl - comDE / P_comC and P_xyl - comDE / P_comAB was measured in MCSE inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of P_comC and P_comAB responds directly on the CSP concentration.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
INCOMPATIBLE WITH RFC[21]
Illegal BglII site found at 1164
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

@@ Line 4: / Line 4: @@
 Quorum sensing two component system (histidine kinase comD, response regulator comE) of ''Streptococcus pneumoniae'' (R6) able to sense the competence stimulating peptide CSP.
-CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides. [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)] [https://parts.igem.org/Part:BBa_K1351024 BBa_K1351024], [https://parts.igem.org/Part:BBa_K1351025 BBa_K1351025] are BioBricks containing CEbs form different promoters of ''S. pneumoniae''.
+CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. [https://parts.igem.org/Part:BBa_K1351024 BBa_K1351024], [https://parts.igem.org/Part:BBa_K1351025 BBa_K1351025] are BioBricks containing CEbs form different promoters of ''S. pneumoniae''.
 [[File:LMU14 ComEdep promoters.png|600px]]
@@ Line 12: / Line 12: @@
-This part contains optimized RBS for ''Bacillus subtilis'' and was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
+This part contains optimized RBS for ''Bacillus subtilis'' (in contrast to [https://parts.igem.org/Part:BBa_K1351015 BBa_K1351015] were the native RBS was maintained) and was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
 {|
@@ Line 23: / Line 23: @@
 Sites of restriction enzymes generating compatible overhangs have the same color:
 <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined.
+This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
+First results of this BioBrick are depicted in the following bar chart:
+[[File:LMU14_comCAssay.jpg|500px]]
+Luminescence of ''B. subtilis'' P<sub>''xyl''</sub> - ''comDE'' P<sub>''comC''</sub> was measured in MCSE inducing 0.02 % xylose and different CSP concentrations (0 mg/ml, 100 mg/ml and 1000 mg/ml). This bar chart represents the luminescence output two hours after inducing with CSP. Induction of P<sub>''comC''</sub> with 1000 mg/ml CSP showed a 3 fold increased luminescence output compared with an induction of 0 mg/ml and 100 mg/ml CSP.
+In the following graph, a dose response curve of the two CSP inducible promoters P<sub>''comC''</sub> and P<sub>''comAB''</sub> is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.
+[[File:LMU14_doseresponse.png|500px]]
+Again, luminescence of ''B. subtilis'' P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comC''</sub> and P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comAB''</sub> was measured in MCSE inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of P<sub>''comC''</sub> and P<sub>''comAB''</sub> responds directly on the CSP concentration.
 <!-- Add more about the biology of this part here