Difference between revisions of "Part:BBa K1351016"
(23 intermediate revisions by 2 users not shown) | |||
Line 2: | Line 2: | ||
<partinfo>BBa_K1351016 short</partinfo> | <partinfo>BBa_K1351016 short</partinfo> | ||
− | Quorum sensing two component system (histidine kinase comD, response regulator comE) of ''Streptococcus pneumoniae'' (R6) able to sense the competence stimulating peptide CSP | + | Quorum sensing two component system (histidine kinase comD, response regulator comE) of ''Streptococcus pneumoniae'' (R6) able to sense the competence stimulating peptide CSP. |
− | [[ | + | CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. [https://parts.igem.org/Part:BBa_K1351024 BBa_K1351024], [https://parts.igem.org/Part:BBa_K1351025 BBa_K1351025] are BioBricks containing CEbs form different promoters of ''S. pneumoniae''. |
− | This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix: | + | [[File:LMU14 ComEdep promoters.png|600px]] |
+ | |||
+ | ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)] | ||
+ | |||
+ | |||
+ | |||
+ | This part contains optimized RBS for ''Bacillus subtilis'' (in contrast to [https://parts.igem.org/Part:BBa_K1351015 BBa_K1351015] were the native RBS was maintained) and was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix: | ||
{| | {| | ||
Line 17: | Line 23: | ||
Sites of restriction enzymes generating compatible overhangs have the same color: | Sites of restriction enzymes generating compatible overhangs have the same color: | ||
− | <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined. | + | <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined. |
+ | |||
+ | |||
+ | This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus]. | ||
+ | |||
+ | |||
+ | First results of this BioBrick are depicted in the following bar chart: | ||
+ | |||
+ | [[File:LMU14_comCAssay.jpg|500px]] | ||
+ | |||
+ | Luminescence of ''B. subtilis'' P<sub>''xyl''</sub> - ''comDE'' P<sub>''comC''</sub> was measured in MCSE inducing 0.02 % xylose and different CSP concentrations (0 mg/ml, 100 mg/ml and 1000 mg/ml). This bar chart represents the luminescence output two hours after inducing with CSP. Induction of P<sub>''comC''</sub> with 1000 mg/ml CSP showed a 3 fold increased luminescence output compared with an induction of 0 mg/ml and 100 mg/ml CSP. | ||
+ | |||
+ | In the following graph, a dose response curve of the two CSP inducible promoters P<sub>''comC''</sub> and P<sub>''comAB''</sub> is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP. | ||
+ | |||
+ | [[File:LMU14_doseresponse.png|500px]] | ||
+ | |||
+ | Again, luminescence of ''B. subtilis'' P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comC''</sub> and P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comAB''</sub> was measured in MCSE inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of P<sub>''comC''</sub> and P<sub>''comAB''</sub> responds directly on the CSP concentration. | ||
+ | |||
+ | |||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Latest revision as of 18:34, 31 October 2014
comDE Quorum Sensing two component system (Freiburg Standard)
Quorum sensing two component system (histidine kinase comD, response regulator comE) of Streptococcus pneumoniae (R6) able to sense the competence stimulating peptide CSP.
CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351024, BBa_K1351025 are BioBricks containing CEbs form different promoters of S. pneumoniae.
ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]
This part contains optimized RBS for Bacillus subtilis (in contrast to BBa_K1351015 were the native RBS was maintained) and was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
prefix with EcoRI, NotI, XbaI, SD and NgoMIV: | GAATTCCGCGGCCGCTTCTAGATAAGGAGGAGCCGGC |
suffix with AgeI, SpeI, NotI and PstI: | ACCGGTTAATACTAGTAGCGGCCGCTGCAG |
Sites of restriction enzymes generating compatible overhangs have the same color:
EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV and AgeI in orange. Shine-Dalgarno sequence and stop codons are underlined.
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
First results of this BioBrick are depicted in the following bar chart:
Luminescence of B. subtilis Pxyl - comDE PcomC was measured in MCSE inducing 0.02 % xylose and different CSP concentrations (0 mg/ml, 100 mg/ml and 1000 mg/ml). This bar chart represents the luminescence output two hours after inducing with CSP. Induction of PcomC with 1000 mg/ml CSP showed a 3 fold increased luminescence output compared with an induction of 0 mg/ml and 100 mg/ml CSP.
In the following graph, a dose response curve of the two CSP inducible promoters PcomC and PcomAB is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.
Again, luminescence of B. subtilis Pxyl - comDE / PcomC and Pxyl - comDE / PcomAB was measured in MCSE inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of PcomC and PcomAB responds directly on the CSP concentration.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1164
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]