Difference between revisions of "Part:BBa K1351022"
(→‎FsrA: a small RNA Represses Expression of Succinate Dehydrogenase)
 
(9 intermediate revisions by 3 users not shown)
Line 1: Line 1:
−
<partinfo>BBa_K1351022 short</partinfo>
+
__NOTOC__
−
Regulatory rRNA wich binds the binding site sdhC´. The idea was to build follwing composite Part: Promotor - sdhC´- gene of interest. Then expressing the rRNA fsrA it should bind the sdhC´ sequence and then disturb the transcription.  
+
<partinfo>BBa_K1351022 short</partinfo><br>
−
In detail check the 20014 LMU-munich iGEM team site.
+
 
 +
This part was generated with the RFC10 standard and has the following prefix and suffix:
 +
 
 +
{|
 +
|prefix with EcoRI, NotI and XbaI:
 +
|<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>G
 +
|-
 +
|suffix with SpeI, NotI and PstI:
 +
|T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>
 +
|}
 +
Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red.
 +
 
 +
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
 +
 
 +
 
 +
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
 +
 
 +
 
 +
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
 +
 
 +
===FsrA: a small RNA Represses Expression of Succinate Dehydrogenase===
 +
 
 +
Regulation of bacterial iron homeostasis is often controlled by the iron-sensing ferric uptake repressor (Fur). The ''Bacillus subtilis'' Fur protein acts as an iron-dependent repressor for siderophore biosynthesis and iron transport proteins. Furthermore it also coordinates an iron-sparing response that acts to repress the expression of iron-rich proteins (e.g. succinate dehydrogenase) when iron is limited. It has been shown that the downregulation of succinate dehydrogenase (SDH) is most likely caused by complementary binding of a small RNA, named fsrA, to the leader region of the sdhCAB mRNA, namely SdhC' (Fig. 1).  
 +
 
 +
[[File:Background_Fig.5.png|thumb|600px|center|Fig. 1. Predicted pairing between fsrA and the 5’-leader region of sdhC, the first gene of the sdhCAB operon.]]
 +
 
 +
<!-- Add more about the biology of this part here
 +
===Usage and Biology===
 +
 
 +
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K1351022 SequenceAndFeatures</partinfo>
 +
 
 +
 
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K1351022 parameters</partinfo>
 +
<!-- -->

Latest revision as of 18:58, 30 October 2014

FsrA: Fur-regulated sRNA which binds the binding site sdhC

This part was generated with the RFC10 standard and has the following prefix and suffix:

prefix with EcoRI, NotI and XbaI: GAATTCGCGGCCGCTTCTAGAG
suffix with SpeI, NotI and PstI: TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].


Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]


This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

FsrA: a small RNA Represses Expression of Succinate Dehydrogenase

Regulation of bacterial iron homeostasis is often controlled by the iron-sensing ferric uptake repressor (Fur). The Bacillus subtilis Fur protein acts as an iron-dependent repressor for siderophore biosynthesis and iron transport proteins. Furthermore it also coordinates an iron-sparing response that acts to repress the expression of iron-rich proteins (e.g. succinate dehydrogenase) when iron is limited. It has been shown that the downregulation of succinate dehydrogenase (SDH) is most likely caused by complementary binding of a small RNA, named fsrA, to the leader region of the sdhCAB mRNA, namely SdhC' (Fig. 1).

Fig. 1. Predicted pairing between fsrA and the 5’-leader region of sdhC, the first gene of the sdhCAB operon.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]