Difference between revisions of "Part:BBa K1352004"
 
(11 intermediate revisions by the same user not shown)
Line 26: Line 26:
  
  
 +
Confirmation of K1352004 DNA construct and the insertion of a MCS
  
 +
[[File:IMG 1071.JPG|600px|thumb|left|Figure 2]]
 +
Figure 2; a restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)
  
  
−
Florescence Microscopy
 
−
The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.
 
−
 
  
  
  
  
−
[[File:Fluorescence_negative_control.PNG|600px|thumb|left|Figure 1, Panel A]]
 
−
Figure 1, Panel A; a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.
 
  
  
Line 72: Line 70:
  
  
−
[[File:K523013 positive control.PNG|600px|thumb|left|Figure 1, Panel B]]
 
−
Figure 1, Panel B; a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.
 
  
  
 +
For figure 2: L stands for 10,000bp – 500bp DNA marker “ladder”, and the numbers indicate the following:
  
  
 +
9. K1352004 plasmid undigested
  
 +
10. K1352004 plasmid digested with XbaI
  
 +
11. K1352004 plasmid digested with XbaI and HindIII
  
 +
12. K1352004 plasmid digested with XbaI and BglII
  
  
 +
[[File:IMG_1072.JPG|600px|thumb|left|Figure 3]]
 +
Figure 3; a restriction digest verification of plasmid K1352004
  
  
Line 111: Line 114:
  
  
−
[[File:K1352004 YFP fluorescence.PNG|600px|thumb|left|Figure 1, Panel C]]
 
−
Figure 1, Panel C; a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.
 
  
  
Line 121: Line 122:
  
  
 +
For figure 3: the letters indicate the following:
  
 +
L. 10,000bp – 500bp DNA marker “ladder”
  
 +
N. K1352004 plasmid digested with no enzymes
  
 +
E. K1352004 plasmid digested with EcoRI
  
 +
X. K1352004 plasmid digested with XbaI
  
 +
S. K1352004 plasmid digested with SpeI
  
 +
P. K1352004 plasmid digested with PstI
  
 +
EP. K1352004 plasmid digested with EcoRI and PstI
  
 +
SX. K1352004 plasmid digested with XbaI and Spe1
  
  
 +
DNA Sequencing
 +
The recombinant plasmid was Sanger-sequenced with the following sequencing primers.  “G101” is a reverse primer, the rest are forward primers.
  
 +
“G101” (attaccgcctttgagtgagc)
  
 +
“G100” (tgccacctgacgtctaagaa)
  
 +
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)
  
 +
“36 INP-SEQ 2” (gaggttgctgttgccgac)
  
 +
“37 INP-SEQ 3” (ggtgtggaagccgacattc)
  
 +
The plasmid insert was found to be exactly as desired.  Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).
  
 +
[[File:MCS in INP-YFP-FLAG.JPG|600px|thumb|left|Figure 5]]
  
  
Line 150: Line 169:
  
  
−
Confirmation of K1352004 DNA construct and the insertion of a MCS
 
  
−
[[File:K1352004, K523013, INP-YFP-His digest gel.png|600px|thumb|left|Figure 2]]
 
−
Figure 2; a restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)
 
  
  
Line 170: Line 186:
  
  
 +
Florescence Microscopy
 +
The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.
 +
  
  
  
−
For figure 2: L stands for 10,000bp – 500bp DNA marker “ladder”, and the numbers indicate the following:
 
  
−
1. INP-YFP-His plasmid undigested
+
[[File:Fluorescence_negative_control.PNG|600px|thumb|left|Figure 1, Panel A]]
 +
Figure 1, Panel A; a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.
  
−
2. INP-YFP-His plasmid digested with XbaI
 
  
−
3. INP-YFP-His plasmid digested with XbaI and HindIII
 
  
−
4. INP-YFP-His plasmid digested with XbaI and BglII
 
  
−
5. K523013 plasmid undigested
 
  
−
6. K523013 plasmid digested with XbaI
 
  
−
7. K523013 plasmid digested with XbaI and HindIII
 
  
−
8. K523013 plasmid digested with XbaI and BglII
 
  
−
9. K1352004 plasmid undigested
 
  
−
10. K1352004 plasmid digested with XbaI
 
  
−
11. K1352004 plasmid digested with XbaI and HindIII
 
  
−
12. K1352004 plasmid digested with XbaI and BglII
 
  
  
−
[[File:K1352004 standard digest.png|600px|thumb|left|Figure 3]]
 
−
Figure 3; a restriction digest verification of plasmid K1352004
 
  
  
Line 223: Line 229:
  
  
 +
[[File:K523013 positive control.PNG|600px|thumb|left|Figure 1, Panel B]]
 +
Figure 1, Panel B; a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.
  
  
Line 244: Line 252:
  
  
−
For figure 3: the letters indicate the following:
 
  
−
L. 10,000bp – 500bp DNA marker “ladder”
 
  
−
N. K1352004 plasmid digested with no enzymes
 
  
−
E. K1352004 plasmid digested with EcoRI
 
  
−
X. K1352004 plasmid digested with XbaI
 
  
−
S. K1352004 plasmid digested with SpeI
 
  
−
P. K1352004 plasmid digested with PstI
 
  
−
EP. K1352004 plasmid digested with EcoRI and PstI
 
  
−
XS. K1352004 plasmid digested with XbaI and Spe1
 
  
−
Western Blot to confirm the presence and size of the translated INP-YFP-FLAG protein
 
  
−
[[File:Western blot K1352004.png|600px|thumb|left|Figure 4]]
 
−
Figure 4,
 
  
  
Line 272: Line 268:
  
  
 +
[[File:K1352004 YFP fluorescence.PNG|600px|thumb|left|Figure 1, Panel C]]
 +
Figure 1, Panel C; a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.
  
  
Line 311: Line 309:
  
  
 +
Western Blot to confirm the presence and size of the translated INP-YFP-FLAG protein
  
 +
[[File:Western blot K1352004.png|600px|thumb|left|Figure 4]]
 +
Figure 4,
  
  
Line 335: Line 336:
  
  
−
For figure 4 nitrocellulose paper, from left-to-right the lanes are:
 
  
−
1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1
 
  
−
2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2
 
  
−
3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1
 
  
−
4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2
 
  
−
5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3
 
  
−
6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4
 
  
−
7. Protein marker “ladder”
 
  
−
DNA Sequencing
 
−
The recombinant plasmid was Sanger-sequenced with the following sequencing primers.  “G101” is a reverse primer, the rest are forward primers.
 
  
−
“G101” (attaccgcctttgagtgagc)
 
  
−
“G100” (tgccacctgacgtctaagaa)
 
  
−
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)
 
  
−
“36 INP-SEQ 2” (gaggttgctgttgccgac)
 
  
−
“37 INP-SEQ 3” (ggtgtggaagccgacattc)
 
  
−
The plasmid insert was found to be exactly as desired.  Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).
 
  
−
[[File:MCS in INP-YFP-FLAG.JPG|600px|thumb|left|Figure 5]]
 
  
  
Line 391: Line 375:
  
  
 +
 +
For figure 4 nitrocellulose paper, from left-to-right the lanes are:
 +
 +
1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1
 +
 +
2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2
 +
 +
3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1
 +
 +
4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2
 +
 +
5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3
 +
 +
6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4
 +
 +
7. Pre-stained protein marker “ladder” NuPAGE MES; From top to bottom in kDa: 188, 98 (orange), 62, 49, 38, 28, 17 (purple), 14, 6, 3
 +
 +
The four Ag43 lanes act as a negative control, they also contain a single FLAG-tag but Ag43 is a heavier protein than INP and as such has a different banding pattern.
 +
 +
  
  
 +
Discussion
  
 
Conclusions
 
Conclusions
−
The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the C-terminus of YFP.  However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies; it was for this reason that BBa_K1352006 was created.
+
The part is RFC 10 compatible.  The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the C-terminus of YFP.  However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies; it was for this reason that BBa_K1352006 was created.
  
  

Latest revision as of 23:43, 13 October 2014

Ice Nucleation Protein (INP) Yellow Florescent Protein (YFP) FLAG-tag

K1352004 is a part which has a FLAG-tag octapeptide flanked by a multiple cloning site (MCS) inserted into Bba_K523013 (K523013 expresses ice nucleation protein (INP) fused to yellow florescent protein (YFP) by a linker); specifically, on the end of the C-terminus of yellow florescence protein (YFP) and is in the same reading frame as INP+YFP. The FLAG-tag is a BglII restriction site, followed by a FLAG octapeptide, followed by a HindIII restriction site; the sequence of which is as follows; the octapeptide is uppercase, the restriction sites are lowercase:

(agatctGATTATAAAGATGATGATGATAAAaagctt)

Attaching a FLAG-tag to the end of YFP means that it will be expressed on the surface of the cell, the purpose of this is to allow the rapid insertion (via the MCS) of polypeptides (an antigen for example) to the C-terminus end of INP+YFP; this allows the surface expression of said polypeptide. For the 2014 Aberdeen iGEM project, this part was intended to be used as a trypanosome antigen displayer.


Creation of INP-YFP-FLAG fragments followed by InFusion cloning Four infusion primers (primers with one homologous half (lower case) to the template, and one “overhang” half (upper case), the last 15 nucleotides of which is homologous to another DNA fragment) were designed.

“INP-VEC-F” (CGCGGCCGCTTCTAGAttaatacgactcactataggg)

“INP-FLAG-R” (AAGCTTTTTATCATCATCATCTTTATAATCAGATCTcttgtacagctcgtccatgc)

“INP-FLAG-F” (AGATCTGATTATAAAGATGATGATGATAAAAAGCTTtaataatactagcaacatatcataacggagtg)

“INP-VEC-R” (AGCGGCCGCTACTAGTtataaacgcagaaaggccc)

Two INP-YFP-FLAG fragments were created by PCR amplification, both use K523013 as the template, the first uses “INP-VEC-F” and “INP-FLAG-R” primers, the second uses “INP-VEC-R” and “INP-FLAG-F” primers. The Clontech InFusion kit was used to recombine the two INP-YFP-FLAG fragments with pSB1C3 backbone (cut with Xba1 and Spe1); this kit was followed according to the manufacturer’s instructions.


Confirmation of K1352004 DNA construct and the insertion of a MCS

Figure 2

Figure 2; a restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)






















For figure 2: L stands for 10,000bp – 500bp DNA marker “ladder”, and the numbers indicate the following:


9. K1352004 plasmid undigested

10. K1352004 plasmid digested with XbaI

11. K1352004 plasmid digested with XbaI and HindIII

12. K1352004 plasmid digested with XbaI and BglII


Figure 3

Figure 3; a restriction digest verification of plasmid K1352004



















For figure 3: the letters indicate the following:

L. 10,000bp – 500bp DNA marker “ladder”

N. K1352004 plasmid digested with no enzymes

E. K1352004 plasmid digested with EcoRI

X. K1352004 plasmid digested with XbaI

S. K1352004 plasmid digested with SpeI

P. K1352004 plasmid digested with PstI

EP. K1352004 plasmid digested with EcoRI and PstI

SX. K1352004 plasmid digested with XbaI and Spe1


DNA Sequencing The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers.

“G101” (attaccgcctttgagtgagc)

“G100” (tgccacctgacgtctaagaa)

“35 INP-SEQ 1” (ccgattcattaatgcagctgg)

“36 INP-SEQ 2” (gaggttgctgttgccgac)

“37 INP-SEQ 3” (ggtgtggaagccgacattc)

The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).

Figure 5















Florescence Microscopy The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.



Figure 1, Panel A

Figure 1, Panel A; a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.


















Figure 1, Panel B

Figure 1, Panel B; a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.



















Figure 1, Panel C

Figure 1, Panel C; a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.




















Western Blot to confirm the presence and size of the translated INP-YFP-FLAG protein

Figure 4

Figure 4,
































For figure 4 nitrocellulose paper, from left-to-right the lanes are:

1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1

2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2

3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1

4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2

5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3

6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4

7. Pre-stained protein marker “ladder” NuPAGE MES; From top to bottom in kDa: 188, 98 (orange), 62, 49, 38, 28, 17 (purple), 14, 6, 3

The four Ag43 lanes act as a negative control, they also contain a single FLAG-tag but Ag43 is a heavier protein than INP and as such has a different banding pattern.



Discussion

Conclusions The part is RFC 10 compatible. The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the C-terminus of YFP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies; it was for this reason that BBa_K1352006 was created.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 2324
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1036
  • 1000
    COMPATIBLE WITH RFC[1000]