Difference between revisions of "Part:BBa K1352002"

m
m
 
(10 intermediate revisions by the same user not shown)
Line 10: Line 10:
 
<br><br><br><br>
 
<br><br><br><br>
 
<font size="3">'''1.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Structure and function'''</font><br><br>
 
<font size="3">'''1.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Structure and function'''</font><br><br>
<p align="justify">Antigen 43 (sometimes called Ag43 or fluffing protein) is a phase-variable outer membrane protein encoded by flu gene. It is native to E.Coli K12 strain and is usually expressed at about 50, 000 copies/cell. Ag34 precursor is 1039 amino acids long and subsequently becomes cleaved into alpha and beta chains (499 and 488 amino acids long respectively). The beta subunit forms a β-barrel pore via which alpha-subunit translocates to the cell surface, and with which it remains non-covalently joined. The surface alpha chain can be released by a brief heat treatment at approx. 60<sup>o</sup>C.
+
<p align="justify">Antigen 43 (sometimes called Ag43 or fluffing protein) is a phase-variable outer membrane protein encoded by flu gene. It is native to <i>E.coli</i> K12 strain and is usually expressed at about 50, 000 copies/cell. Ag34 precursor is 1039 amino acids long and subsequently becomes cleaved into alpha and beta chains (499 and 488 amino acids long respectively). The beta subunit forms a β-barrel pore via which alpha-subunit translocates to the cell surface, and with which it remains non-covalently joined. The surface alpha chain can be released by a brief heat treatment at approx. 60<sup>o</sup>C.
 
Ag43 is an autotransporter protein, therefore it possesses all information necessary for translocation to the cell surface in its coding sequence.
 
Ag43 is an autotransporter protein, therefore it possesses all information necessary for translocation to the cell surface in its coding sequence.
Ag43 mediates autoaggregation, via a velcro-like mechanism (Heras et. al., 2014), and plays a role in E.coli biofilm formation.
+
Ag43 mediates autoaggregation, via a velcro-like mechanism (Heras et. al., 2014), and plays a role in <i>E.coli</i> biofilm formation.
Interestingly, the alpha subunit is able to express foreign peptide sequences on E.coli cell surface if inserted just in front of codon 148 (Kjærgaard et. al., 2002).</p><br><br>
+
Interestingly, the alpha subunit is able to express foreign peptide sequences on <i>E.coli</i> cell surface if inserted just in front of codon 148 (Kjærgaard et. al., 2002).</p><br><br>
 
[[File:K1352001_image11.png|center|]]
 
[[File:K1352001_image11.png|center|]]
 
<br>
 
<br>
 
<font size="2" color="#800517"><center>Fig. 1&nbsp;&nbsp;Graphic representation of Ag43 autotransporter structure and process of autotransportation. <br>
 
<font size="2" color="#800517"><center>Fig. 1&nbsp;&nbsp;Graphic representation of Ag43 autotransporter structure and process of autotransportation. <br>
 
Source: Kjærgaard et. al., 2000; Van der Woude & Henderson, 2008 (modified)
 
Source: Kjærgaard et. al., 2000; Van der Woude & Henderson, 2008 (modified)
</center></font>
+
</center></font><br><br><br>
  
 
<font size="3">'''2.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Rationale for β-hairpins removal '''</font><br><br>
 
<font size="3">'''2.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Rationale for β-hairpins removal '''</font><br><br>
 
<p align="justify">The shape of α-subunit of Ag43 resembles letter L (Fig.2). It consists of a 'β-helix domain [which forms] the stem of the letter L, followed by three rungs flanked by four β-hairpin motifs that bend the protein by about 110° and a C-terminal (...) parallel β-helix domain [which forms] the bottom of the letter L' (Heras et. al., 2014). It has been indicated that this unique shape plays a crucial role in cell-to-cell aggregation via velcro-like mechanism, in which α-subunits form a dimer by coling around each other. This interaction is strengthened by Van der Waals interactions, hydrogen bonds and salt bridges facilitated by the L-shape (Heras et. al., 2014). Recent research demonstrates that disruption of the bend and straightening of the shape by removal of two β-hairpin sequences eliminates self-association of Ag43 proteins (Heras et. al., 2014). Removal of β-hairpins does not interfere with protein translocation to the cell surface membrane. </p><br><br>
 
<p align="justify">The shape of α-subunit of Ag43 resembles letter L (Fig.2). It consists of a 'β-helix domain [which forms] the stem of the letter L, followed by three rungs flanked by four β-hairpin motifs that bend the protein by about 110° and a C-terminal (...) parallel β-helix domain [which forms] the bottom of the letter L' (Heras et. al., 2014). It has been indicated that this unique shape plays a crucial role in cell-to-cell aggregation via velcro-like mechanism, in which α-subunits form a dimer by coling around each other. This interaction is strengthened by Van der Waals interactions, hydrogen bonds and salt bridges facilitated by the L-shape (Heras et. al., 2014). Recent research demonstrates that disruption of the bend and straightening of the shape by removal of two β-hairpin sequences eliminates self-association of Ag43 proteins (Heras et. al., 2014). Removal of β-hairpins does not interfere with protein translocation to the cell surface membrane. </p><br><br>
 
Hairpin 1 sequence &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 268 &nbsp;&nbsp;&nbsp; AATVTGTNRLGAFSVVA &nbsp;&nbsp;&nbsp; 284<br><br>
 
Hairpin 1 sequence &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 268 &nbsp;&nbsp;&nbsp; AATVTGTNRLGAFSVVA &nbsp;&nbsp;&nbsp; 284<br><br>
Hairpin 2 sequence &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 341 &nbsp;&nbsp;&nbsp; GAAVSGTRSDGKAFSIG &nbsp;&nbsp;&nbsp; 357<br>
+
Hairpin 2 sequence &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 341 &nbsp;&nbsp;&nbsp; GAAVSGTRSDGKAFSIG &nbsp;&nbsp;&nbsp; 357<br><br><br>
  
 
[[File:Beta_2.png|center|]]
 
[[File:Beta_2.png|center|]]
 
<br>
 
<br>
<font size="2" color="#800517"><center> Fig.2&nbsp;&nbsp;A) Graphic representation of Ag43 alpha-subunit; B) Interaction between two alpha-subunits in a velcro-like mechanism of auto-aggregation; C) Disruption of L-shape and linearization of the alpha-subunit eliminates auto-aggregation. <br>Source: change (modified)</center></font>
+
<font size="2" color="#800517"><center> Fig.2&nbsp;&nbsp;A) Graphic representation of Ag43 alpha-subunit; B) Interaction between two alpha-subunits in a velcro-like mechanism of auto-aggregation; C) Disruption of L-shape and linearization of the alpha-subunit eliminates auto-aggregation. <br>Source: Heras et. al., 2014 (modified)</center></font>
  
  
Line 38: Line 38:
 
</p>
 
</p>
 
<br><br><br><br>
 
<br><br><br><br>
<font size="3">'''3.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Template for foreign peptide insertion'''</font><br><br>
+
<font size="3">'''4.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Template for foreign peptide insertion'''</font><br><br>
 
<p align="justify">Depending on the length, desired foreign peptide sequence can be purchased as oligos or a synthetic piece of DNA. In order to keep the foreign protein sequence in-frame, a following template should be used:</p>
 
<p align="justify">Depending on the length, desired foreign peptide sequence can be purchased as oligos or a synthetic piece of DNA. In order to keep the foreign protein sequence in-frame, a following template should be used:</p>
 
<br>
 
<br>
Line 49: Line 49:
 
<br>
 
<br>
 
<br>
 
<br>
[[File:Beta_3.png|center|]]
+
[[File:Beta_3.png|center|]]<br>
  
 
<font size="2" color="#800517"><center>Fig. 3&nbsp;&nbsp; Plasmid map of Bba_K1352001 BioBrick. Position of β-hairpins indicated </center></font><br><br><br>
 
<font size="2" color="#800517"><center>Fig. 3&nbsp;&nbsp; Plasmid map of Bba_K1352001 BioBrick. Position of β-hairpins indicated </center></font><br><br><br>
<u>In-fusion primers used</u><br>
+
<u>In-fusion primers used</u><br><br>
 
Removal of β-hairpin 1 (GCTGCAACCGTTACCGGCATAAACCGCCTGGGAGCATTCTCTGTTGTGGAG)<br>
 
Removal of β-hairpin 1 (GCTGCAACCGTTACCGGCATAAACCGCCTGGGAGCATTCTCTGTTGTGGAG)<br>
 
Primer A: ATTATCAGCTTTACCCGTACTGGTAACCAGTGCGCCG <br>
 
Primer A: ATTATCAGCTTTACCCGTACTGGTAACCAGTGCGCCG <br>
 
Primer 1: GGTAAAGCTGATAATGTCGTACTGGAAAATGGCGGAC  <br>
 
Primer 1: GGTAAAGCTGATAATGTCGTACTGGAAAATGGCGGAC  <br>
<br><br>
 
  
 
Removal of β-hairpin 2 (GGTGCCGCTGTCAGTGGTACCCGGAGCGACGGAAAGGCATTCAGTATCGGA )<br>
 
Removal of β-hairpin 2 (GGTGCCGCTGTCAGTGGTACCCGGAGCGACGGAAAGGCATTCAGTATCGGA )<br>
Line 62: Line 61:
 
Primer B: CTGCTGGCCGATTCCGGCGGTCAGGCGGATGC<br>
 
Primer B: CTGCTGGCCGATTCCGGCGGTCAGGCGGATGC<br>
 
<br><br><br><br>
 
<br><br><br><br>
<font size="3">'''5.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Construct testing - molecular biology aspect'''</font>
+
<font size="3">'''6.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Construct testing - molecular biology aspect'''</font>
<br><br>
+
<br>
  
  
Line 69: Line 68:
 
''a) Diagnostic restriction digests''<br>
 
''a) Diagnostic restriction digests''<br>
 
<p align="justify"> A double digest with XbaI and KpnI was performed in order to screen for clones lacking β-hairpin sequences. KpnI is a unique cutter, which recognizes G_GTAC^C sequence. It cuts uniquely within the β-hairpin 2 sequence.</p><br><br>
 
<p align="justify"> A double digest with XbaI and KpnI was performed in order to screen for clones lacking β-hairpin sequences. KpnI is a unique cutter, which recognizes G_GTAC^C sequence. It cuts uniquely within the β-hairpin 2 sequence.</p><br><br>
[[File:Beta_4.png|center|]]
+
[[File:Beta_4.png|center|]]<br>
 
<font size="2" color="#800517"><center>Fig. 4&nbsp;&nbsp;KpnI cut site within Ag43 coding sequence. </center></font><br><br>
 
<font size="2" color="#800517"><center>Fig. 4&nbsp;&nbsp;KpnI cut site within Ag43 coding sequence. </center></font><br><br>
[[File:Beta_5.png|center|]]
+
[[File:Beta_5.png|center|]]<br>
 
<font size="2" color="#800517"><center>Fig. 5&nbsp;&nbsp;XbaI+KpnI digest of Bba_K1352001 (A) and Bba_K1352002 (B). </center></font><br><br>
 
<font size="2" color="#800517"><center>Fig. 5&nbsp;&nbsp;XbaI+KpnI digest of Bba_K1352001 (A) and Bba_K1352002 (B). </center></font><br><br>
 
<p align="justify"> Bba_K1352001 was used as a control. Since it contains β-hairpin sequences, two prominent bands corresponding to 2.5 kb and 4.1 kb are present confirming presence of one XbaI and one KpnI cut sites. Clone with removed β-hairpins yield a single band, which corresponds to plasmid linearization by XbaI (6.5 kb); KpnI did not cut the plasmid, which suggests that β-hairpin 2 was removed. <br><br>In addition, a range of single and double restriction digests was carried out in order to ensure that no major indels occurred in the process of In-Fusion and created BioBrick behaves as expected and yields desired band pattern.</p><br><br>
 
<p align="justify"> Bba_K1352001 was used as a control. Since it contains β-hairpin sequences, two prominent bands corresponding to 2.5 kb and 4.1 kb are present confirming presence of one XbaI and one KpnI cut sites. Clone with removed β-hairpins yield a single band, which corresponds to plasmid linearization by XbaI (6.5 kb); KpnI did not cut the plasmid, which suggests that β-hairpin 2 was removed. <br><br>In addition, a range of single and double restriction digests was carried out in order to ensure that no major indels occurred in the process of In-Fusion and created BioBrick behaves as expected and yields desired band pattern.</p><br><br>
Line 78: Line 77:
 
<p align="justify">Single digests with EcoRI, XbaI, SpeI, PstI, BglII and HindIII cause a single cut within the vector and therefore result in plasmid linearization. As expected, in all cases a single band at 6.5 kB position is visible, which corresponds to the full size of a vector. <br>
 
<p align="justify">Single digests with EcoRI, XbaI, SpeI, PstI, BglII and HindIII cause a single cut within the vector and therefore result in plasmid linearization. As expected, in all cases a single band at 6.5 kB position is visible, which corresponds to the full size of a vector. <br>
 
EcoRI+PstI and XbaI+SpeI result in the release of a BioBrick construct from a vector yielding two fragments of 4.5kb+2kb and 4.4kb+2.1 kb respectively.<br>
 
EcoRI+PstI and XbaI+SpeI result in the release of a BioBrick construct from a vector yielding two fragments of 4.5kb+2kb and 4.4kb+2.1 kb respectively.<br>
Double digests with BglII+SpeI and HindIII+XbaI were carried out in order to confirm the presence of FLAG+MCS.<br></p>
+
Double digests with BglII+SpeI and HindIII+XbaI were carried out in order to confirm the presence of FLAG+MCS.<br></p><br>
TABLE!!!!
+
[[File:table_1.png|center|]]
  
 
<br><br><br>''b) Confirming BioBrick Bba_K1352002 construction with DNA sequencing''<br>
 
<br><br><br>''b) Confirming BioBrick Bba_K1352002 construction with DNA sequencing''<br>
 
<p align="justify">Our Ag43+FLAG+MCS(-)β-hairpins was sequenced by the DNA Sequencing & Services Unit, Dundee University. </p><br><br>
 
<p align="justify">Our Ag43+FLAG+MCS(-)β-hairpins was sequenced by the DNA Sequencing & Services Unit, Dundee University. </p><br><br>
TABLE!!!
+
[[File:table_2.png|center|]]<br>
 
<p align="justify"> Sequencing primers spaced approximately every 600 bp were used to ensure good coverage. Fragments were combined together using Clustal Omega and yield a high confidence reading along the entire sequence. It confirmed the absence of two β-hairpins at expected locations; open reading frame remained unaffected. Our construct sequence was identical to that of the protein product of Bba_K1352001, with the exception of the protein sequence encoded in the β-hairpins.</p>
 
<p align="justify"> Sequencing primers spaced approximately every 600 bp were used to ensure good coverage. Fragments were combined together using Clustal Omega and yield a high confidence reading along the entire sequence. It confirmed the absence of two β-hairpins at expected locations; open reading frame remained unaffected. Our construct sequence was identical to that of the protein product of Bba_K1352001, with the exception of the protein sequence encoded in the β-hairpins.</p>
  
 
<br><br>
 
<br><br>
[[File:Beta_7.png|center|]]
+
[[File:Beta_11.png|center|]]<br>
 
<font size="2" color="#800517"><center>Fig. 7&nbsp;&nbsp; Confirmation of the removal of β-hairpin 1. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 1 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 1 clearly visible.</center></font><br><br>
 
<font size="2" color="#800517"><center>Fig. 7&nbsp;&nbsp; Confirmation of the removal of β-hairpin 1. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 1 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 1 clearly visible.</center></font><br><br>
 
<br><br>
 
<br><br>
[[File:Beta_8.png|center|]]
+
[[File:Beta_12.png|center|]]<br>
 
<font size="2" color="#800517"><center>Fig. 8&nbsp;&nbsp; Confirmation of the removal of β-hairpin 2. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 2 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 2 clearly visible.</center></font><br><br>
 
<font size="2" color="#800517"><center>Fig. 8&nbsp;&nbsp; Confirmation of the removal of β-hairpin 2. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 2 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 2 clearly visible.</center></font><br><br>
 
<br>
 
<br>
[[File:Beta_9.png|center|]]
+
[[File:Beta_9.png|center|]]<br>
 
<font size="2" color="#800517"><center>Fig. 9&nbsp;&nbsp; Translation of: Query - Bba_K1352001; Subject - Bba_K1352002. Translation of β-hairpin sequences indicated in yellow.</center></font><br>
 
<font size="2" color="#800517"><center>Fig. 9&nbsp;&nbsp; Translation of: Query - Bba_K1352001; Subject - Bba_K1352002. Translation of β-hairpin sequences indicated in yellow.</center></font><br>
  
 
<br><br>
 
<br><br>
<font size="3">'''8.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Testing the physiology and function of Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002)'''</font>
+
<font size="3">'''7.&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Testing the physiology and function of Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002)'''</font>
 
<br><br>
 
<br><br>
  
Line 103: Line 102:
 
<p align="justify"> Overnight cultures of Ag43+FLAG+MCS, Ag43+FLAG+MCS(-)β-hairpins and Ag43 were transferred onto sterile glass test tubes, induced with 0.2% arabinose and incubated in a shaking water bath at 37oC for >2hrs. Subsequently, test tubes were removed from the water bath and photographed for visual investigation for aggregation.</p>
 
<p align="justify"> Overnight cultures of Ag43+FLAG+MCS, Ag43+FLAG+MCS(-)β-hairpins and Ag43 were transferred onto sterile glass test tubes, induced with 0.2% arabinose and incubated in a shaking water bath at 37oC for >2hrs. Subsequently, test tubes were removed from the water bath and photographed for visual investigation for aggregation.</p>
 
<br>
 
<br>
[[File:Beta_10.png|center|]]
+
[[File:Beta_10.png|center|]]<br>
<font size="2" color="#800517"><center>Fig. 10&nbsp;&nbsp; Aggregation after induction with 0.2% arabinose of A) Ag43 without FLAG (Bba_K1352000); B) Ag43+FLAG+MCS (Bba_K1352001); Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002).</center></font><br><br>
+
<font size="2" color="#800517"><center>Fig. 10&nbsp;&nbsp; Aggregation after induction with 0.2% arabinose of A) Ag43 without FLAG (Bba_K1352000); B) Ag43+FLAG+MCS (Bba_K1352001);<br> Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002).</center></font><br><br>
  
<p align="justify"> A clear difference is visible between aggregation levels of tested BioBricks. Ag43 clearly aggregates when induced with arabinose. Suprisingly, Ag43+FLAG+MCS does not display aggregation properties, even though it possesses β-hairpin sequences. We hypothesize that insertion of foreign peptide sequences, in this case FLAG tag epitope, slightly changes the shape of Ag43 at places critical for clumping and disrupts velcro-like mechanism of aggregation. Ag43+FLAG+MCS(-)β-hairpins also does not display any aggregation properties. Although we cannot confirm that this is due to removal of β-hairpin sequences and not presence of a FLAG tag epitope sequence due to lack of Ag43(-)FLAG(-)β-hairpins, literature evidence provided evidence that the lack of aggregation properties is due to removal of β-hairpins and would persist if FLAG+MCS were removed (Heras et. al., 2014).<br>
+
<p align="justify"> A clear difference is visible between aggregation levels of tested BioBricks. Ag43 clearly aggregates when induced with arabinose. Suprisingly, Ag43+FLAG+MCS does not display aggregation properties, even though it possesses β-hairpin sequences. We hypothesize that insertion of foreign peptide sequences, in this case FLAG tag epitope, slightly changes the shape of Ag43 at places critical for clumping and disrupts velcro-like mechanism of aggregation. Ag43+FLAG+MCS(-)β-hairpins also does not display any aggregation properties. Although we cannot confirm that this is due to removal of β-hairpin sequences and not presence of a FLAG tag epitope sequence due to lack of Ag43(-)FLAG(-)β-hairpins, literature evidence provided evidence that the lack of aggregation properties is due to removal of β-hairpins and would persist if FLAG+MCS were removed (Heras et. al., 2014).<br><br>
 
Since the lack of aggregation properties in Bba_K1352001 may be foreign peptide sequence specific, created BioBrick Bba_K1352002 which lacks β-hairpins is still a useful construct which can be utilized in a range of projects where aggregation is undesirable. <br><br>
 
Since the lack of aggregation properties in Bba_K1352001 may be foreign peptide sequence specific, created BioBrick Bba_K1352002 which lacks β-hairpins is still a useful construct which can be utilized in a range of projects where aggregation is undesirable. <br><br>
<u>Note:</u>
+
<font color="red">Note:</font>
 
Further characterization is needed in order to determine whether removal of β-hairpin sequences does not interfere with foreign peptides expression on cell surface membrane.</p>
 
Further characterization is needed in order to determine whether removal of β-hairpin sequences does not interfere with foreign peptides expression on cell surface membrane.</p>
  
  
  
<br><br><br><br>
+
<br><br><br>
 
<font size="3">'''References'''</font><br><br>
 
<font size="3">'''References'''</font><br><br>
 
1)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Heras, B., Totsika, M., Peters, K. M., Paxman, J. J., Gee, C. L., Jarrott, R. J., & Schembri, M. A. (2014). The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping. Proceedings of the National Academy of Sciences, 111(1), 457-462.<br>
 
1)&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;Heras, B., Totsika, M., Peters, K. M., Paxman, J. J., Gee, C. L., Jarrott, R. J., & Schembri, M. A. (2014). The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping. Proceedings of the National Academy of Sciences, 111(1), 457-462.<br>

Latest revision as of 19:06, 12 October 2014

Ag43+FLAG+MCS(-)beta-hairpins under pBAD promoter


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 1205
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1678
    Illegal BamHI site found at 1144
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1981
    Illegal NgoMIV site found at 3103
    Illegal NgoMIV site found at 3613
    Illegal NgoMIV site found at 3634
    Illegal AgeI site found at 979
    Illegal AgeI site found at 2629
    Illegal AgeI site found at 3373
    Illegal AgeI site found at 3787
    Illegal AgeI site found at 4029
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI site found at 961



Abstract

We describe the creation of Biobrick constrct Bba_K1352002 which expresses autotransporter Ag43 with an inserted FLAG epitope tag at codon 148, flanked by multiple cloning restriction sites. Two 17 amino acids long beta hairpins were removed from Ag43 in order to eliminate native aggregation properties. We describe the design and construction of the new Biobrick, and its verification using restriction digestion and DNA sequencing. We show that removal of β-hairpins removes auto-aggregation capability of Ag43, creating a useful reagent that can be used for E. coli surface display.





1.       Structure and function

Antigen 43 (sometimes called Ag43 or fluffing protein) is a phase-variable outer membrane protein encoded by flu gene. It is native to E.coli K12 strain and is usually expressed at about 50, 000 copies/cell. Ag34 precursor is 1039 amino acids long and subsequently becomes cleaved into alpha and beta chains (499 and 488 amino acids long respectively). The beta subunit forms a β-barrel pore via which alpha-subunit translocates to the cell surface, and with which it remains non-covalently joined. The surface alpha chain can be released by a brief heat treatment at approx. 60oC. Ag43 is an autotransporter protein, therefore it possesses all information necessary for translocation to the cell surface in its coding sequence. Ag43 mediates autoaggregation, via a velcro-like mechanism (Heras et. al., 2014), and plays a role in E.coli biofilm formation. Interestingly, the alpha subunit is able to express foreign peptide sequences on E.coli cell surface if inserted just in front of codon 148 (Kjærgaard et. al., 2002).



K1352001 image11.png


Fig. 1  Graphic representation of Ag43 autotransporter structure and process of autotransportation.

Source: Kjærgaard et. al., 2000; Van der Woude & Henderson, 2008 (modified)




2.        Rationale for β-hairpins removal

The shape of α-subunit of Ag43 resembles letter L (Fig.2). It consists of a 'β-helix domain [which forms] the stem of the letter L, followed by three rungs flanked by four β-hairpin motifs that bend the protein by about 110° and a C-terminal (...) parallel β-helix domain [which forms] the bottom of the letter L' (Heras et. al., 2014). It has been indicated that this unique shape plays a crucial role in cell-to-cell aggregation via velcro-like mechanism, in which α-subunits form a dimer by coling around each other. This interaction is strengthened by Van der Waals interactions, hydrogen bonds and salt bridges facilitated by the L-shape (Heras et. al., 2014). Recent research demonstrates that disruption of the bend and straightening of the shape by removal of two β-hairpin sequences eliminates self-association of Ag43 proteins (Heras et. al., 2014). Removal of β-hairpins does not interfere with protein translocation to the cell surface membrane.



Hairpin 1 sequence         268     AATVTGTNRLGAFSVVA     284

Hairpin 2 sequence         341     GAAVSGTRSDGKAFSIG     357


Beta 2.png


Fig.2  A) Graphic representation of Ag43 alpha-subunit; B) Interaction between two alpha-subunits in a velcro-like mechanism of auto-aggregation; C) Disruption of L-shape and linearization of the alpha-subunit eliminates auto-aggregation.
Source: Heras et. al., 2014 (modified)






3.       Biobrick description and potential uses

BioBrick Bba_K1352002 is a modified version of the Bba_K1352001 BioBrick. It is composed of an Ag43 coding sequence with an in-frame FLAG epitope tag flanked by BglII and HindIII multiple cloning sites inserted within the alpha-subunit in front of codon 148 of Ag43. Two β-hairpin forming sequences were removed from the Ag43 coding sequence, maintaining ORF. Expression of Ag43 is under the control of the pBAD promoter; it includes a ribosome binding site as well as two transcriptional terminators. Structure of the BioBrick was designed to allow easy insertion of foreign protein sequences of choice at codon 148 with a simple restriction digest with BglII and HindIII followed by ligation in cases where aggregation is undesirable.
Potential uses of this BioBrick include surface display of foreign peptide sequences and synthetic vaccines production.





4.       Template for foreign peptide insertion

Depending on the length, desired foreign peptide sequence can be purchased as oligos or a synthetic piece of DNA. In order to keep the foreign protein sequence in-frame, a following template should be used:


5' gct gtg AGA TCT (your sequence) AAG CTT aac acc 3'

BglII recognition site; HindIII recognition site; sequence adjacent to foreign peptide insertion site





5.       Making of the Biobrick and plasmid modularization

Bba_K1352001 BioBrick (Ag43+FLAG+MCS) was a starting material for this construct. Two β-hairpins were removed via In-Fusion reaction (Clonetech). For more information regarding the construction of this BioBrick please see: http://2014.igem.org/Team:Aberdeen_Scotland/Parts



Beta 3.png

Fig. 3   Plasmid map of Bba_K1352001 BioBrick. Position of β-hairpins indicated



In-fusion primers used

Removal of β-hairpin 1 (GCTGCAACCGTTACCGGCATAAACCGCCTGGGAGCATTCTCTGTTGTGGAG)
Primer A: ATTATCAGCTTTACCCGTACTGGTAACCAGTGCGCCG
Primer 1: GGTAAAGCTGATAATGTCGTACTGGAAAATGGCGGAC

Removal of β-hairpin 2 (GGTGCCGCTGTCAGTGGTACCCGGAGCGACGGAAAGGCATTCAGTATCGGA )
Primer 2: GGAATCGGCCAGCAGTACACCGC
Primer B: CTGCTGGCCGATTCCGGCGGTCAGGCGGATGC




6.       Construct testing - molecular biology aspect


a) Diagnostic restriction digests

A double digest with XbaI and KpnI was performed in order to screen for clones lacking β-hairpin sequences. KpnI is a unique cutter, which recognizes G_GTAC^C sequence. It cuts uniquely within the β-hairpin 2 sequence.



Beta 4.png

Fig. 4  KpnI cut site within Ag43 coding sequence.


Beta 5.png

Fig. 5  XbaI+KpnI digest of Bba_K1352001 (A) and Bba_K1352002 (B).


Bba_K1352001 was used as a control. Since it contains β-hairpin sequences, two prominent bands corresponding to 2.5 kb and 4.1 kb are present confirming presence of one XbaI and one KpnI cut sites. Clone with removed β-hairpins yield a single band, which corresponds to plasmid linearization by XbaI (6.5 kb); KpnI did not cut the plasmid, which suggests that β-hairpin 2 was removed.

In addition, a range of single and double restriction digests was carried out in order to ensure that no major indels occurred in the process of In-Fusion and created BioBrick behaves as expected and yields desired band pattern.



Beta 6.png
Fig. 6  Diagnostic restriction digest panel.


Single digests with EcoRI, XbaI, SpeI, PstI, BglII and HindIII cause a single cut within the vector and therefore result in plasmid linearization. As expected, in all cases a single band at 6.5 kB position is visible, which corresponds to the full size of a vector.
EcoRI+PstI and XbaI+SpeI result in the release of a BioBrick construct from a vector yielding two fragments of 4.5kb+2kb and 4.4kb+2.1 kb respectively.
Double digests with BglII+SpeI and HindIII+XbaI were carried out in order to confirm the presence of FLAG+MCS.


Table 1.png




b) Confirming BioBrick Bba_K1352002 construction with DNA sequencing

Our Ag43+FLAG+MCS(-)β-hairpins was sequenced by the DNA Sequencing & Services Unit, Dundee University.



Table 2.png

Sequencing primers spaced approximately every 600 bp were used to ensure good coverage. Fragments were combined together using Clustal Omega and yield a high confidence reading along the entire sequence. It confirmed the absence of two β-hairpins at expected locations; open reading frame remained unaffected. Our construct sequence was identical to that of the protein product of Bba_K1352001, with the exception of the protein sequence encoded in the β-hairpins.



Beta 11.png

Fig. 7   Confirmation of the removal of β-hairpin 1. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 1 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 1 clearly visible.




Beta 12.png

Fig. 8   Confirmation of the removal of β-hairpin 2. 1) Scheme of a starting construct Bba_K1352001; 2) theoretical construct with β-hairpin 2 removed; 3) Sequencing results of created Bba_K1352002 BioBrick; 4) Alignment of a) Bba_K1352001 and b) Bba_K1352002 construct sequences. Removal of β-hairpin 2 clearly visible.



Beta 9.png

Fig. 9   Translation of: Query - Bba_K1352001; Subject - Bba_K1352002. Translation of β-hairpin sequences indicated in yellow.



7.        Testing the physiology and function of Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002)

a) Testing the aggregation properties of Ag43+FLAG+MCS

Overnight cultures of Ag43+FLAG+MCS, Ag43+FLAG+MCS(-)β-hairpins and Ag43 were transferred onto sterile glass test tubes, induced with 0.2% arabinose and incubated in a shaking water bath at 37oC for >2hrs. Subsequently, test tubes were removed from the water bath and photographed for visual investigation for aggregation.


Beta 10.png

Fig. 10   Aggregation after induction with 0.2% arabinose of A) Ag43 without FLAG (Bba_K1352000); B) Ag43+FLAG+MCS (Bba_K1352001);
Ag43+FLAG+MCS(-)β-hairpins (Bba_K1352002).


A clear difference is visible between aggregation levels of tested BioBricks. Ag43 clearly aggregates when induced with arabinose. Suprisingly, Ag43+FLAG+MCS does not display aggregation properties, even though it possesses β-hairpin sequences. We hypothesize that insertion of foreign peptide sequences, in this case FLAG tag epitope, slightly changes the shape of Ag43 at places critical for clumping and disrupts velcro-like mechanism of aggregation. Ag43+FLAG+MCS(-)β-hairpins also does not display any aggregation properties. Although we cannot confirm that this is due to removal of β-hairpin sequences and not presence of a FLAG tag epitope sequence due to lack of Ag43(-)FLAG(-)β-hairpins, literature evidence provided evidence that the lack of aggregation properties is due to removal of β-hairpins and would persist if FLAG+MCS were removed (Heras et. al., 2014).

Since the lack of aggregation properties in Bba_K1352001 may be foreign peptide sequence specific, created BioBrick Bba_K1352002 which lacks β-hairpins is still a useful construct which can be utilized in a range of projects where aggregation is undesirable.

Note: Further characterization is needed in order to determine whether removal of β-hairpin sequences does not interfere with foreign peptides expression on cell surface membrane.





References

1)     Heras, B., Totsika, M., Peters, K. M., Paxman, J. J., Gee, C. L., Jarrott, R. J., & Schembri, M. A. (2014). The antigen 43 structure reveals a molecular Velcro-like mechanism of autotransporter-mediated bacterial clumping. Proceedings of the National Academy of Sciences, 111(1), 457-462.
2)     Kjærgaard, K., Schembri, M. A., Hasman, H., & Klemm, P. (2000). Antigen 43 from Escherichia coli induces inter-and intraspecies cell aggregation and changes in colony morphology of Pseudomonas fluorescens. Journal of bacteriology, 182(17), 4789-4796.
3)     Kjærgaard, K., Hasman, H., Schembri, M. A., & Klemm, P. (2002). Antigen 43-mediated autotransporter display, a versatile bacterial cell surface presentation system. Journal of bacteriology, 184(15), 4197-4204.
4)     Van der Woude, M. W., & Henderson, I. R. (2008). Regulation and function of Ag43 (flu). Annu. Rev. Microbiol., 62, 153-169.