Difference between revisions of "Part:BBa K1395003:Design"

 
(→‎Design Notes)
 
(One intermediate revision by the same user not shown)
Line 9: Line 9:
 
Cys1 gene have restriction site for EcoR1 and Pst1 and therefore was not compatible for 3A assembly. To clone this part using 3 assembly we amplify the part using primers containing site for different restriction enzyme but having same flanking sequences. Cys1 gene was our part B in the 3A assembly, so it was to be restricted digested by Xba1 and Pst1. Hence, we designed primers such that at rear end part had a site of Nsi1 which has same flanking sequence as that of Pst1. Now this PCR amplified part was restriction digested with Nsi1 and Xba1. pSB1C3 (plasmid backbone) was digested with EcoR1 and Pst1. Then both parts were ligated with backbone using 3A assembly.
 
Cys1 gene have restriction site for EcoR1 and Pst1 and therefore was not compatible for 3A assembly. To clone this part using 3 assembly we amplify the part using primers containing site for different restriction enzyme but having same flanking sequences. Cys1 gene was our part B in the 3A assembly, so it was to be restricted digested by Xba1 and Pst1. Hence, we designed primers such that at rear end part had a site of Nsi1 which has same flanking sequence as that of Pst1. Now this PCR amplified part was restriction digested with Nsi1 and Xba1. pSB1C3 (plasmid backbone) was digested with EcoR1 and Pst1. Then both parts were ligated with backbone using 3A assembly.
  
−
Cys1-FP:: ATGTCTAGAGAGGAGGAAAAAAATGTACGTATACGACGAG
+
Cys1-FP:: ATGTCTAGAGAGGAGGAAAAAAATGTACGTATACGACGAG                                                                            
 
Cys1-RP:: CCAATGCATCCTGCAGCGGCCGCTACTATATTAATGATTC
 
Cys1-RP:: CCAATGCATCCTGCAGCGGCCGCTACTATATTAATGATTC
  
−
We designed this Biobrick as mentioned we had used a constitutive promoter Bba_J23119 (member of Anderson family). This promoter consists the RBS itself. This was succeeded by part for sqr gene (Bba_K896000) . Then we were constrained to apply any RFC10 further so we designed primers for Cys1 which also contains commonly used RBS Sequence (Shine Dalgarno Sequence).  
+
We designed this Biobrick as mentioned we had used a constitutive promoter Bba_J23119 (member of Anderson family). This promoter consists the RBS itself. This was succeeded by part for sqr gene (Bba_K896000) . Then we were constrained to apply any RFC10 further so we designed primers for Cys1 which also contains commonly used RBS Sequence (Shine Dalgarno Sequence).
  
 +
[[File:BBa_K1395003_SOx_clone_final_biobrick_design.PNG|800px|center|alt text]]
  
 +
[[File:BBa_K1395003_S0x_clone_final_vector_map.PNG|800px|center|alt text]]
 +
 +
[[File:SDS_12.jpg|800px|center|alt text]]
  
 
===Source===
 
===Source===

Latest revision as of 03:32, 18 October 2014


sqr gene (sulfide quinone reductase) and cysI gene (sulfur reductase) under constitutive promoter


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal EcoRI site found at 1997
    Illegal PstI site found at 1463
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 1997
    Illegal NheI site found at 7
    Illegal NheI site found at 30
    Illegal PstI site found at 1463
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 1997
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal EcoRI site found at 1997
    Illegal PstI site found at 1463
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal EcoRI site found at 1997
    Illegal PstI site found at 1463
    Illegal NgoMIV site found at 1736
    Illegal NgoMIV site found at 1922
    Illegal NgoMIV site found at 2064
    Illegal AgeI site found at 1436
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 390
    Illegal BsaI site found at 1472
    Illegal BsaI site found at 2794


Design Notes

Cys1 gene have restriction site for EcoR1 and Pst1 and therefore was not compatible for 3A assembly. To clone this part using 3 assembly we amplify the part using primers containing site for different restriction enzyme but having same flanking sequences. Cys1 gene was our part B in the 3A assembly, so it was to be restricted digested by Xba1 and Pst1. Hence, we designed primers such that at rear end part had a site of Nsi1 which has same flanking sequence as that of Pst1. Now this PCR amplified part was restriction digested with Nsi1 and Xba1. pSB1C3 (plasmid backbone) was digested with EcoR1 and Pst1. Then both parts were ligated with backbone using 3A assembly.

Cys1-FP:: ATGTCTAGAGAGGAGGAAAAAAATGTACGTATACGACGAG Cys1-RP:: CCAATGCATCCTGCAGCGGCCGCTACTATATTAATGATTC

We designed this Biobrick as mentioned we had used a constitutive promoter Bba_J23119 (member of Anderson family). This promoter consists the RBS itself. This was succeeded by part for sqr gene (Bba_K896000) . Then we were constrained to apply any RFC10 further so we designed primers for Cys1 which also contains commonly used RBS Sequence (Shine Dalgarno Sequence).

alt text
alt text
alt text

Source

Basically this Biobrick is a composite part which is created by two genes regulated by same constitutive promoter. This is made up of parts which we got from biobricks Bba_K896000 and Bba_K896001. Out of these Biobricks Bba_K896000 encodes sulfide quinone reductase (Source Synechococcus sp. PCC 7002) and Bba_K896001 encodes sulfite reductase, Cys1 (Source:Pseudomonas aeruginosa strain PAO1).


References