Difference between revisions of "Part:BBa K1351025"

 
(7 intermediate revisions by 2 users not shown)
Line 2: Line 2:
 
<partinfo>BBa_K1351025 short</partinfo>
 
<partinfo>BBa_K1351025 short</partinfo>
  
CSP-depending promoter of ''Streptococcus pneumoniae'' (R6). This regulatory site has been shown to trigger ComE dependent expression in ''S. pneumoniae'' [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay].
+
CSP-depending promoter P<sub>''comAB''</sub> of the two component system ComDE ([https://parts.igem.org/Part:BBa_K1351015 BBa_K1351015], [https://parts.igem.org/Part:BBa_K1351016 BBa_K1351016]) in ''Streptococcus pneumoniae'' (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within ''S. pneumoniae'' [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay].
 +
 
 +
 
 +
CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. [https://parts.igem.org/Part:BBa_K1351024 BBa_K1351024] is another BioBrick containing ''comC'' promoter of ''S. pneumoniae'' with an other CEbs.
 +
 
 +
[[File:LMU14 ComEdep promoters.png|600px]]
 +
 
 +
ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]
 +
 
  
  
Line 14: Line 22:
 
|T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>
 
|T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>
 
|}
 
|}
Sites of restriction enzymes generating compatible overhangs have the same color:
+
Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red.
  
<span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red.
+
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
 +
 
 +
In the following graph, a dose response curve of the two CSP inducible promoters P<sub>''comC''</sub> and P<sub>''comAB''</sub> is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.
 +
 
 +
[[File:LMU14_doseresponse.png|500px]]
 +
 
 +
Luminescence of ''B. subtilis'' P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comC''</sub> and P<sub>''xyl''</sub> - ''comDE'' / P<sub>''comAB''</sub> was measured growing the cultures in MCSE and inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of P<sub>''comC''</sub> and P<sub>''comAB''</sub> responds directly on the CSP concentration.  
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 30: Line 44:
 
<partinfo>BBa_K1351025 parameters</partinfo>
 
<partinfo>BBa_K1351025 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===References===
 +
<biblio>
 +
 +
#1 ComE/ComE~P interplay dictates activation or extinction status of pneumococcal X-state (competence). Martin et al (2012) [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]
 +
 +
</biblio>

Latest revision as of 11:59, 26 October 2014

PcomAB, a CSP inducible promoter derived from Streptococcus pneumoniae

CSP-depending promoter PcomAB of the two component system ComDE (BBa_K1351015, BBa_K1351016) in Streptococcus pneumoniae (R6). This regulatory site has been shown to be sufficient to drive ComE regulated transcription within S. pneumoniae [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay].


CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351024 is another BioBrick containing comC promoter of S. pneumoniae with an other CEbs.

LMU14 ComEdep promoters.png

ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]


This part was generated with the RFC10 standard and has the following prefix and suffix:

prefix with EcoRI, NotI and XbaI: GAATTCGCGGCCGCTTCTAGAG
suffix with SpeI, NotI and PstI: TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

In the following graph, a dose response curve of the two CSP inducible promoters PcomC and PcomAB is depicted. The dose response curve was generating using luminescence values two hours after inducing with CSP.

LMU14 doseresponse.png

Luminescence of B. subtilis Pxyl - comDE / PcomC and Pxyl - comDE / PcomAB was measured growing the cultures in MCSE and inducing with 0.02 % xylose and different CSP concentrations (100 ng/ml, 300ng/ml, 500 ng/ml, 1000 ng/ml, 3000 ng/ml, 5000 ng/ml, 8000 ng/ml and 10000 ng/ml). The activation of PcomC and PcomAB responds directly on the CSP concentration.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

<biblio>

  1. 1 ComE/ComE~P interplay dictates activation or extinction status of pneumococcal X-state (competence). Martin et al (2012) [http://www.ncbi.nlm.nih.gov/pubmed/?term=comE%2FcomE~P+interplay]

</biblio>