Difference between revisions of "Part:BBa K1351011"

 
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1351011 short</partinfo>
 
<partinfo>BBa_K1351011 short</partinfo>
Line 7: Line 6:
 
A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the ''B. subtilis'' cell wall (Liew ''et. al.'', 2012). It was used in the [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus BaKillus project] to display pathogen-specific peptides and mediate adhesion of ''B. subtlis'' to pathogens.  
 
A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the ''B. subtilis'' cell wall (Liew ''et. al.'', 2012). It was used in the [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus BaKillus project] to display pathogen-specific peptides and mediate adhesion of ''B. subtlis'' to pathogens.  
  
−
It consists of four components: the sortase substrate with a signal peptide (this part), a linker ([https://parts.igem.org/Part:BBa_K1351009 BBa_K1351009]) and a cell wall-anchoring domain ([https://parts.igem.org/Part:BBa_K1351010 BBa_K1351010]) as well as the sortase YhcS itself ([https://parts.igem.org/Part:BBa_K1351011 BBa_K1351011]), whose overexpression increases the efficiency of the surface display.
+
It consists of four components: the sortase substrate with a signal peptide ([https://parts.igem.org/Part:BBa_K1351008 BBa_K1351008]), a linker ([https://parts.igem.org/Part:BBa_K1351009 BBa_K1351009]) and a cell wall-anchoring domain ([https://parts.igem.org/Part:BBa_K1351010 BBa_K1351010]) as well as the sortase YhcS itself (this part), whose overexpression increases the efficiency of the surface display.
  
  
−
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:  
+
This part was generated in RFC10 with the following prefix and suffix:  
  
 
{|
 
{|
Line 16: Line 15:
 
|<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>GT<u>AAGGAGG</u>A<span style="color:orange">GCCGGC</span>
 
|<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>GT<u>AAGGAGG</u>A<span style="color:orange">GCCGGC</span>
 
|-
 
|-
−
|suffix with AgeI, SpeI, NotI and PstI:
+
|suffix with SpeI, NotI and PstI:  
−
|<span style="color:orange">ACCGGT</span><u>TAA</u>T<span style="color:red">AC<u>TAG</u><u>T</u></span><u>A</u><span style="color:green"><u>G</u>CGGCCGC</span><span style="color:blue">CTGCAG</span>
+
|T<span style="color:red">AC<u>TAG</u><u>T</u></span><u>A</u><span style="color:green"><u>G</u>CGGCCG</span><span style="color:blue">CTGCAG</span>
 
|}
 
|}
 
Sites of restriction enzymes generating compatible overhangs have the same color:
 
Sites of restriction enzymes generating compatible overhangs have the same color:
  
−
<span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> and <span style="color:orange">AgeI</span> in orange. Shine-Dalgarno sequence and stop codons are underlined.
+
<span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red, <span style="color:orange">NgoMIV</span> in orange. Shine-Dalgarno sequence and stop codons are underlined.
  
  
Line 28: Line 27:
  
 
<!-- -->
 
<!-- -->
−
<span class='h3bb'>Sequence and Features</span>
+
===Sequence and Features===
 
<partinfo>BBa_K1351011 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1351011 SequenceAndFeatures</partinfo>
  

Latest revision as of 15:46, 5 October 2014

Bacillus subtilis sortase YhcS

Bacillus subtilis sortase YhcS (UniProt [http://www.uniprot.org/uniprot/P54603 P54603]), responsible for anchoring its substrae YhcR (UniProt [http://www.uniprot.org/uniprot/P54602 P54602]) covalently to the peptidoglycan wall of B. subtilis.

A YhcR-based surface display system has been shown to covalently anchor heterologous proteins to the B. subtilis cell wall (Liew et. al., 2012). It was used in the [http://2014.igem.org/Team:LMU-Munich/Project/Bakillus BaKillus project] to display pathogen-specific peptides and mediate adhesion of B. subtlis to pathogens.

It consists of four components: the sortase substrate with a signal peptide (BBa_K1351008), a linker (BBa_K1351009) and a cell wall-anchoring domain (BBa_K1351010) as well as the sortase YhcS itself (this part), whose overexpression increases the efficiency of the surface display.


This part was generated in RFC10 with the following prefix and suffix:

prefix with EcoRI, NotI, XbaI, SD and NgoMIV: GAATTCGCGGCCGCTTCTAGAGTAAGGAGGAGCCGGC
suffix with SpeI, NotI and PstI: TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color:

EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red, NgoMIV in orange. Shine-Dalgarno sequence and stop codons are underlined.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 34
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 199
    Illegal SapI.rc site found at 508