|
|
(6 intermediate revisions by the same user not shown) |
Line 18: |
Line 18: |
| <!-- End of the user review template --> | | <!-- End of the user review template --> |
| <!-- DON'T DELETE --><partinfo>BBa_K1352004 EndReviews</partinfo> | | <!-- DON'T DELETE --><partinfo>BBa_K1352004 EndReviews</partinfo> |
− |
| |
− |
| |
− |
| |
− | Florescence Microscopy
| |
− | The following composite images were produced by superimposing a bright-field image with an YFP-filtered image.
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | [[File:Fluorescence_negative_control.PNG|600px|thumb|left|Figure 1, Panel A]]
| |
− | Figure 1, Panel A; a composite fluorescence image – brightfield micrograph of a pSB1A3-transformed liquid cell culture (negative control) exhibiting no fluorescence as expected.
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | [[File:K523013 positive control.PNG|600px|thumb|left|Figure 1, Panel B]]
| |
− | Figure 1, Panel B; a composite fluorescence image – brightfield micrograph of a K523013-transformed liquid cell culture exhibiting yellow fluorescence as expected.
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | [[File:K1352004 YFP fluorescence.PNG|600px|thumb|left|Figure 1, Panel C]]
| |
− | Figure 1, Panel C; a composite fluorescence image – brightfield micrograph of a K1352004-transformed liquid cell culture exhibiting yellow fluorescence.
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− |
| |
− | Confirmation of K1352004 DNA construct and the insertion of a MCS
| |
− |
| |
− |
| |
− | Figure 2; a restriction digest verification of plasmids K1352004, K523013, and “INP-YFP-His” (a previously created plasmid which identical to K1352004 except that the FLAG tag is a 6xHis tag)
| |
− |
| |
− | For figure 2: L stands for 10,000bp – 500bp DNA marker “ladder”, and the numbers indicate the following:
| |
− |
| |
− | 1. INP-YFP-His plasmid undigested
| |
− |
| |
− | 2. INP-YFP-His plasmid digested with XbaI
| |
− |
| |
− | 3. INP-YFP-His plasmid digested with XbaI and HindIII
| |
− |
| |
− | 4. INP-YFP-His plasmid digested with XbaI and BglII
| |
− |
| |
− | 5. K523013 plasmid undigested
| |
− |
| |
− | 6. K523013 plasmid digested with XbaI
| |
− |
| |
− | 7. K523013 plasmid digested with XbaI and HindIII
| |
− |
| |
− | 8. K523013 plasmid digested with XbaI and BglII
| |
− |
| |
− | 9. K1352004 plasmid undigested
| |
− |
| |
− | 10. K1352004 plasmid digested with XbaI
| |
− |
| |
− | 11. K1352004 plasmid digested with XbaI and HindIII
| |
− |
| |
− | 12. K1352004 plasmid digested with XbaI and BglII
| |
− |
| |
− |
| |
− | Figure 3; a restriction digest verification of plasmid K1352004
| |
− |
| |
− | For figure 3: the letters indicate the following:
| |
− |
| |
− | L. 10,000bp – 500bp DNA marker “ladder”
| |
− |
| |
− | N. K1352004 plasmid digested with no enzymes
| |
− |
| |
− | E. K1352004 plasmid digested with EcoRI
| |
− |
| |
− | X. K1352004 plasmid digested with XbaI
| |
− |
| |
− | S. K1352004 plasmid digested with SpeI
| |
− |
| |
− | P. K1352004 plasmid digested with PstI
| |
− |
| |
− | EP. K1352004 plasmid digested with EcoRI and PstI
| |
− |
| |
− | XS. K1352004 plasmid digested with XbaI and Spe1
| |
− |
| |
− | Western Blot to confirm the presence and size of the translated INP-YFP-FLAG protein
| |
− |
| |
− |
| |
− | Figure 4,
| |
− |
| |
− | For figure 4 nitrocellulose paper, from left-to-right the lanes are:
| |
− |
| |
− | 1. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #1
| |
− |
| |
− | 2. Induced (with IPTG) K1352004 lysate probed with anti-FLAG antibody #2
| |
− |
| |
− | 3. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #1
| |
− |
| |
− | 4. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #2
| |
− |
| |
− | 5. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #3
| |
− |
| |
− | 6. Induced (with IPTG) Ag43-FLAG lysate probed with anti-FLAG antibody #4
| |
− |
| |
− | 7. Protein marker “ladder”
| |
− |
| |
− | DNA Sequencing
| |
− | The recombinant plasmid was Sanger-sequenced with the following sequencing primers. “G101” is a reverse primer, the rest are forward primers.
| |
− |
| |
− | “G101” (attaccgcctttgagtgagc)
| |
− |
| |
− | “G100” (tgccacctgacgtctaagaa)
| |
− |
| |
− | “35 INP-SEQ 1” (ccgattcattaatgcagctgg)
| |
− |
| |
− | “36 INP-SEQ 2” (gaggttgctgttgccgac)
| |
− |
| |
− | “37 INP-SEQ 3” (ggtgtggaagccgacattc)
| |
− |
| |
− | The plasmid insert was found to be exactly as desired. Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).
| |
− |
| |
− | Conclusions
| |
− | The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of YFP. However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies.
| |
This experience page is provided so that any user may enter their experience using this part.
Please enter
how you used this part and how it worked out.
UNIQ2f7799c57cfcf29e-partinfo-00000000-QINU
UNIQ2f7799c57cfcf29e-partinfo-00000001-QINU