Difference between revisions of "Part:BBa K1351015"

 
 
(7 intermediate revisions by 2 users not shown)
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1351015 short</partinfo>
 
<partinfo>BBa_K1351015 short</partinfo>
  
−
Quorum sensing two component system with native RBS and Terminator (histidine kinase comD, response regulator comE)of Streptococcus pneumoniae (R6) able to sense the competence stimulating peptide CSP.
+
Quorum sensing two component system with native RBS and Terminator (histidine kinase comD, response regulator comE) of ''Streptococcus pneumoniae'' (R6) able to sense the competence stimulating peptide CSP. CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. [https://parts.igem.org/Part:BBa_K1351024 BBa_K1351024], [https://parts.igem.org/Part:BBa_K1351025 BBa_K1351025] are BioBricks containing CEbs form different promoters of ''S. pneumoniae''.
 +
 
 +
[[File:LMU14 ComEdep promoters.png|600px]]
 +
 
 +
ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]
 +
 
 +
 
 +
In contrast to [https://parts.igem.org/Part:BBa_K1351016 BBa_K1351016] the native RBS was maintained, and no optimized RBS for ''Bacillus subtilis'' was added.
 +
 
 +
This part was generated with the RFC10 standard and has the following prefix and suffix:
 +
 
 +
{|
 +
|prefix with EcoRI, NotI and XbaI:
 +
|<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>G
 +
|-
 +
|suffix with SpeI, NotI and PstI:
 +
|T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>
 +
|}
 +
Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red.
  
 +
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Latest revision as of 20:34, 17 October 2014

comDE Quorum Sensing two component system - native

Quorum sensing two component system with native RBS and Terminator (histidine kinase comD, response regulator comE) of Streptococcus pneumoniae (R6) able to sense the competence stimulating peptide CSP. CSP, a 17 amino acids long peptide pheromone, binds to and consequently activates the membrane-embedded sensor kinase ComD by changing the conformation of the polytopic kinase. ComD autophosphorylates and subsequently transphosphorylates the cognate response regulator ComE. ComE acts as transcription activator via binding to -10 promoters regions of early and late competence genes. These ComE binding sites (CEbs) consist of a 9 bp direct repeat separated by a stretch of 12 nucleotides [http://www.ncbi.nlm.nih.gov/pubmed/23216914 (Martin et al. 2013)]. BBa_K1351024, BBa_K1351025 are BioBricks containing CEbs form different promoters of S. pneumoniae.

LMU14 ComEdep promoters.png

ComE dependent promoters containing bases matching (blue) and differing (red) from the CEbs consensus sequence. (figure modified from [http://www.ncbi.nlm.nih.gov/pubmed/23216914 Martin et al. 2013)]


In contrast to BBa_K1351016 the native RBS was maintained, and no optimized RBS for Bacillus subtilis was added.

This part was generated with the RFC10 standard and has the following prefix and suffix:

prefix with EcoRI, NotI and XbaI: GAATTCGCGGCCGCTTCTAGAG
suffix with SpeI, NotI and PstI: TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1183
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]