Difference between revisions of "Part:BBa K1537027"

Latest revision as of 02:57, 12 October 2014

AdCP

Considering the problem of environment and safety, we use male sterility system which prevents the horizontal transgene flow. Pawan Shukla has used a plant pathogen-induced gene, cysteine protease to induce male sterility. This gene was identified in the wild peanut, Arachis diogoi differentially expressed when it was challenged with the late leaf spot pathogen, Phaeoisariopsis personata. Arachis diogoi cysteine protease (AdCP) was expressed under the strong tapetum-specific promoter (TA29).And tobacco transformants were generated.Morphological and histological analysis of AdCP transgenic plants showed ablated tapetum and complete pollen abortion( Shukla P et al，2014).

And because it will take a long time for tobacco to come into flower,here are some datas from paper.

Fig.1 Comparison of flower morphology of male sterile T2 transgenic plants(a) and fully opened non-transformed control plant flower (c).;Fully opened, flower of non-transformed control flower (b, d). Stamen length has been reduced in male sterile transgenic plants (e) compared to the non-transformed control plant (f)

Fig.2 Pollen characteristics of male sterile transformed and untransformed control plants. a and d are Alexander stain images,b, c, e, and f are SEM images. a,b, c Untransformed control plant pollen, d, e, f sterile pollen.(Scale bar 25 μm).

Fig.3 In vitro pollen germination of untransformed control plant and sterile transgenic plants. Pollen grains were germinated on sucrose-boric acid medium and >500 pollen grains were observed. a Untransformed control plant pollen, b Sterile pollen(Scale bar 25 μm).

Fig.4 Transverse section of anther of untransformed control plant (a) and transgenic male sterile plant in T2 generation (b). Observe the copious presence of fertile pollen in the anther sacs of the fertile flower with proper tapetal cell layer, while the sterile anther shows reduced number of pollen grains that are sterile with the ablation of tapetum (T).(Scale bar 50 μm).

References

Shukla P, Singh NK, Kumar D, Vijayan S, Ahmed I, Kirti PB.( 2014)Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco. Funct Integr Genomics.14(2):307-17.

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
INCOMPATIBLE WITH RFC[1000]
Illegal SapI.rc site found at 175

@@ Line 1: / Line 1: @@
 __NOTOC__
 <partinfo>BBa_K1537027 short</partinfo>
-ATGGCTAGGCTCTCTTTATTGTTGTTACTTCTCGTGGCAGCTGTGGCTACCGCAGTTGATGATCAGGCAGATCCTCTCATTAGGCAGGTTACTGATGGAGATCATCACATGCTTAATGCTGAACATCACTTCACTACATTCAAGACTAAGTTCGGAAAGTCTTATGCTACACAAGAAGAGCATGATTACAGATTTGGTGTTTTCAGGGCAAACCTCAGAAGGGCTAAACTTCATGCAAAACTTGATCCTAGTGCTGAGCATGGAGTTACAAAGTTTTCTGATCTTACCCCAGAAGAGTTCAAGAGACAATATCTCGGTTTAAAACCTCTTAGGTTGCCATCAACCGCTAATAAGGCACCTATTCTCCCTACTTCTGATCTTCCTGAAAACTTTGATTGGAGAGATAAGGGAGCTGTTACTCCAGTGAAAAATCAAGGAAGTTGTGGTTCTTGCTGGGCTTTCAGTACCACTGGTGCTCTTGAAGGTGCACATTACTTGTCAACAGGTGAACTCGTTTCTTTATCAGAGCAACAGTTGGTTGATTGTGATCACGTGTGCGATCCTGAAGAGTATGGAGCTTGTGATGCAGGTTGCAACGGAGGTCTTATGAATAACGCTTTCGATTACATTTTGCAAGCAGGAGGTGTGCAGACCGAAAAGGATTATCCATACTCTGGAAGAGATGAGACATGTAAATTTGATAAGTCAAAGGTTGCTGCAACCGTGGCTAACTTCTCAGTTGTGAGTCTCGATGAAGATCAAATCGCTGCAAATCTCGTTAAGCATGGACCTTTAGCTGTGGGAATTAACGCAATTTTCATGCAGACATACATCGGAGGTGTTTCTTGTCCATACATATGCGGAAAAAACTTGGATCACGGTGTTCTTTTGGTGGGATATGGTGCTGCTGGATACGCTCCTATTAGATTCAAGGATAAGCCATTCTGGATTATCAAAAATTCTTGGGGAGAATCATGGGGAGAGGATGGTTATTATAAGATTTGTAGAGGAAAGAATGTTTGTGGTGTGGATTCAATGGTTTCATCTGTGGTTGCTACTACTTTCACTTCATCAAATAACTGA
+Considering the problem of environment and safety, we use male sterility system which prevents the horizontal transgene flow. Pawan Shukla has used a plant pathogen-induced gene, cysteine protease to induce male sterility. This gene was identified in the wild peanut, Arachis diogoi  differentially expressed when it was challenged with the late leaf spot pathogen, Phaeoisariopsis personata.
+Arachis diogoi cysteine protease (AdCP) was expressed under the strong tapetum-specific promoter (TA29).And tobacco transformants were generated.Morphological and histological analysis of AdCP transgenic plants showed ablated tapetum and complete pollen abortion( Shukla P et al，2014).
+And because it will take a long time for tobacco to come into flower,here are some datas from paper.
+[[File:peg.jpg]]
+Fig.1 Comparison of flower morphology of male sterile T2 transgenic plants(a) and fully opened non-transformed control plant flower (c).;Fully opened, flower of non-transformed control flower (b, d). Stamen length has been reduced in male sterile transgenic plants (e) compared to the non-transformed control plant (f)
+[[File:peg-8.jpg]]
+Fig.2 Pollen characteristics of male sterile transformed and untransformed control plants. a and d are Alexander stain images,b, c, e, and f are SEM images. a,b, c Untransformed control plant pollen, d, e, f sterile pollen.(Scale bar 25 μm).
+[[File:peg-9.jpg]]
+Fig.3 In vitro pollen germination of untransformed control plant and sterile transgenic plants. Pollen grains were germinated on sucrose-boric acid medium and >500 pollen grains were observed. a Untransformed control plant pollen, b Sterile pollen(Scale bar 25 μm).
+[[File:peg-10.jpg]]
+Fig.4 Transverse section of anther of untransformed control plant (a) and transgenic male sterile plant in T2 generation (b). Observe the copious presence of fertile pollen in the anther sacs of the fertile flower with proper tapetal cell layer, while the sterile anther shows reduced number of pollen grains that are sterile with the ablation of tapetum (T).(Scale bar 50 μm).
+References
+Shukla P, Singh NK, Kumar D, Vijayan S, Ahmed I, Kirti PB.( 2014)Expression of a pathogen-induced cysteine protease (AdCP) in tapetum results in male sterility in transgenic tobacco. Funct Integr Genomics.14(2):307-17.
 <!-- Add more about the biology of this part here