Difference between revisions of "Part:BBa K1111012:Design"
Sandelisa90 (Talk | contribs) (→Primers) |
Sandelisa90 (Talk | contribs) (→References and acknowledgements) |
||
(8 intermediate revisions by the same user not shown) | |||
Line 5: | Line 5: | ||
==Gibson Assembly Design == | ==Gibson Assembly Design == | ||
− | Insert: we amplified the streptavidin coding sequence received in a plasmid from Mark Howarth laboratory at Oxford university Dept. of Biochemistry. | + | ''Insert:'' we amplified the streptavidin coding sequence received in a plasmid from Mark Howarth laboratory at Oxford university Dept. of Biochemistry. |
− | Backbone: Starting from the biobrick BBa_K523013 (INP fused with YFP), we amplified the whole sequence except the EYFP and added gibson overhang complementary to streptavidin ends. | + | <br>''Backbone:'' Starting from the biobrick BBa_K523013 (INP fused with YFP), we amplified the whole sequence except the EYFP and added gibson overhang complementary to streptavidin ends. |
==Primers== | ==Primers== | ||
− | PCR | + | Streptavidin Alive PCR : |
− | 5' ATGGCTGAAGCTGGTATCACC 3' | + | <br>5' <font color = #0000FF>ATGGCTGAAGCTGGTATCACC</font> 3' |
− | 5' TTAGGAAGCAGCGGACGGTTTAAC 3' | + | <br>5' <font color = #0000FF>TTAGGAAGCAGCGGACGGTTTAAC</font> 3' |
− | + | BBa_K523013 PCR : | |
− | Fw: 5' <font color = | + | <br>Fw: 5' <font color = #0000FF>ACCAAAGTTAAACCGTCCGCTGCTTCT</font><font color= red>AACATATCATAACGGAGTGATCGCAATG</font> 3' |
− | Rev: 5' | + | <br>Rev: 5' <font color = #0000FF>CCAGGTGCCGGTGATACCAGCTTCAGCCAT</font><font color= red>AGATCCCGCCACGCTGCT</font> 3' |
+ | |||
+ | ==Source== | ||
+ | Can be expressed in Escherichia Coli. | ||
==References and acknowledgements== | ==References and acknowledgements== | ||
− | Thanks to the '''Mark Howarth laboratory at Oxford university Dept. of Biochemistry''' | + | Thanks to the '''Mark Howarth laboratory at Oxford university Dept. of Biochemistry''' [http://users.ox.ac.uk/~bioc0756/MyWebs/activesite/ReagentDistribution.htm] for providing us with the streptavidin cloning plasmid. |
− | Thanks | + | <br>Thanks to the '''iGEM team of Edinburgh 2011''' that designed the Biobrick BBa_K523013 [https://parts.igem.org/Part:BBa_K523013]. |
Latest revision as of 21:41, 2 October 2013
Ice Nucleation Protein fused to Streptavidin Alive
- 10INCOMPATIBLE WITH RFC[10]Illegal XbaI site found at 1727
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1649
- 23INCOMPATIBLE WITH RFC[23]Illegal XbaI site found at 1727
- 25INCOMPATIBLE WITH RFC[25]Illegal XbaI site found at 1727
Illegal NgoMIV site found at 1036
Illegal AgeI site found at 1691
Illegal AgeI site found at 1742 - 1000COMPATIBLE WITH RFC[1000]
Gibson Assembly Design
Insert: we amplified the streptavidin coding sequence received in a plasmid from Mark Howarth laboratory at Oxford university Dept. of Biochemistry.
Backbone: Starting from the biobrick BBa_K523013 (INP fused with YFP), we amplified the whole sequence except the EYFP and added gibson overhang complementary to streptavidin ends.
Primers
Streptavidin Alive PCR :
5' ATGGCTGAAGCTGGTATCACC 3'
5' TTAGGAAGCAGCGGACGGTTTAAC 3'
BBa_K523013 PCR :
Fw: 5' ACCAAAGTTAAACCGTCCGCTGCTTCTAACATATCATAACGGAGTGATCGCAATG 3'
Rev: 5' CCAGGTGCCGGTGATACCAGCTTCAGCCATAGATCCCGCCACGCTGCT 3'
Source
Can be expressed in Escherichia Coli.
References and acknowledgements
Thanks to the Mark Howarth laboratory at Oxford university Dept. of Biochemistry [http://users.ox.ac.uk/~bioc0756/MyWebs/activesite/ReagentDistribution.htm] for providing us with the streptavidin cloning plasmid.
Thanks to the iGEM team of Edinburgh 2011 that designed the Biobrick BBa_K523013 [1].