Difference between revisions of "Part:BBa K1139201:Experience"

 
(39 intermediate revisions by 3 users not shown)
Line 1: Line 1:
__NOTOC__
 
 
<partinfo>BBa_K1139201 short</partinfo>
 
<partinfo>BBa_K1139201 short</partinfo>
 +
__TOC__
 +
===Materials and Methods===
 +
<b>1. Construction</b><br>
 +
-pSB6A1-Ptet-<i>GFP</i> (MG1655)… positive control<br>
 +
-pSB6A1-ΔP-<i>GFP</i> (MG1655)… negative control<br>
 +
-pSB6A1-PphoA-<i>GFP</i> (MG1655)…<partinfo>BBa_K1139201</partinfo><br>
  
==1. Materials and Methods==
+
The <i>phoA</i> promoter region of <i>E. coli</i> was amplified from MG1655 genomic DNA by PCR using upstream primer (5’-acgtgaattcgcggccgcttctagagaaagttaatcttttcaacagctgtcataaag-3’) and downstream primer (5’-ccgctactagtaaatacattaaaaaataaaaacaaagcgactataagtctc-3’). Amplification was carried out with the steps shown in Fig. 1.<br>
'''1-1. Construction'''<br>
+
-pSB6A1-Ptet-GFP (MG1655)… positive control<br>
+
-pSB6A1-ΔP-GFP (MG1655)… negative control<br>
+
-pSB6A1-PphoA-GFP (MG1655)…BBa_K1139201<br>
+
  
The ''phoA'' promoter region of ''E. coli'' was amplified from MG1655 genomic DNA by PCR using upstream primer (5’-acgtgaattcgcggccgcttctagagaaagttaatcttttcaacagctgtcataaag
+
[[Image:titech2013_parts_K1139201_exp_Fig1.jpg|thumb|center|360px|<b>Fig. 1.</b> Steps for PCR of the <i>phoA</i> promoter]]
-3’) and downstream primer (5’-ccgctactagtaaatacattaaaaaataaaaacaaagcgactataagtctc
+
-3’). Amplification was carried out with the steps shown in Fig. 1.
+
  
 +
<b>2. Assay Protocol</b><br>
 +
*2-0. Prepare MOPS minimal medium as follows (Neidhardt et al., 1974).<br>
 +
Also, prepare a series of phosphate concentration gradient 1X MOPS by changing the volume of K<sub>2</sub>HPO<sub>4</sub> (We prepared the series as 0, 10, 30, 50, 100, 150, 200, 250, 300, 500, 1000 µM).<br>
  
[[Image:Titech2013_parts_K1139201_EX_Fig1.jpg|thumb|center|500px|'''Fig. 1.''' Steps for PCR of ''phoA'' promoter]]
+
[ Prepare MOPS minimal medium ]<br>
 
+
200 mL of 1X MOPS is prepared as follows.<br>
'''1-2. Assay Protocol'''<br>
+
{| class="wikitable" cellpadding="6"
*1-2-0. Prepare MOPS minimal medium as follows (F. Neidhardt et al., 1974).<br>
+
|<b>Component</b>||<b>Volume</b>
Also, prepare a series of phosphate concentration gradient 1 X MOPS by changing the volume of K<small>2</small>HPO<small>4</small> (We prepared the series as 0, 10, 30, 100, 300, 1000 µM).
+
|-
 
+
|10X MOPS mixture||&nbsp;&nbsp;20 mL
[Prepare MOPS minimal medium]<br>
+
|-
200 mL of 1 X MOPS is prepared as follows.
+
|0.132 M K<sub>2</sub>HPO<sub>4</sub>||&nbsp;&nbsp;&nbsp;&nbsp;2 mL
 
+
|-
[[Image:Titech2013_parts_K1139201_EX_Tab1.jpg|frameless|left|500px|]]<br>
+
|milliQ H<sub>2</sub>O||176 mL
 +
|-
 +
|TOTAL||200 mL
 +
|}
  
 
1. Mix ingredients above and adjust the pH to 7.2 with 5 M NaOH.<br>
 
1. Mix ingredients above and adjust the pH to 7.2 with 5 M NaOH.<br>
Line 28: Line 33:
 
3. Before use, add carbon source (we used a final concentration of 0.1% glucose).<br>
 
3. Before use, add carbon source (we used a final concentration of 0.1% glucose).<br>
  
[10 X MOPS mixture (200 mL)]
+
[ 10X MOPS mixture (200 mL) ]<br>
1. Add the following to ~60 mL milliQ H<small>2</small>O:<br>
+
1. Add the following to ~60 mL milliQ H<sub>2</sub>O:<br>
 
+
{| class="wikitable" cellpadding="6"
[[Image:Titech2013_parts_K1139201_EX_Tab2.jpg|frameless|left|500px|]]<br>
+
|<b>Component</B>||<b>Grams</b>
 +
|-
 +
|MOPS||16.7
 +
|-
 +
|Tricine||&nbsp;&nbsp;1.43
 +
|}
  
 
2. Add 5 M KOH to a final pH of 7.4<br>
 
2. Add 5 M KOH to a final pH of 7.4<br>
 
3. Bring total volume to 88 mL<br>
 
3. Bring total volume to 88 mL<br>
4. Make fresh FeSO<small>4</small> solution and add it to the MOPS/Tricine solution:<br>
+
4. Make fresh FeSO<sub>4</sub> solution and add it to the MOPS/Tricine solution:<br>
 +
{| class="wikitable" cellpadding="6"
 +
|<b>Component</b>||<b>Volume</b>
 +
|-
 +
|0.01 M FeSO<sub>4</sub>•7H<sub>2</sub>O||2 mL
 +
|}
  
[[Image:Titech2013_parts_K1139201_EX_Tab3.jpg|frameless|left|500px|]]<br>
+
5. Add the following solutions to the MOPS/Tricine/FeSO<sub>4</sub> solution<br>
 
+
5. Add the following solutions to the MOPS/Tricine/FeSO<small>4</small> solution<br>
+
 
(Mix in the order shown)<br>
 
(Mix in the order shown)<br>
 
+
{| class="wikitable" cellpadding="6"
[[Image:Titech2013_parts_K1139201_EX_Tab4.jpg|frameless|left|500px|]]<br>
+
|<b>Component</b>||<b>Volume</b>
 +
|-
 +
|1.9 M NH<sub>4</sub>Cl||10 mL
 +
|-
 +
|0.276 M K<sub>2</sub>SO<sub>4</sub>||&nbsp;&nbsp;2 mL
 +
|-
 +
|0.02 M CaCl<sub>2</sub>•H<sub>2</sub>O||&nbsp;&nbsp;0.05 mL
 +
|-
 +
|2.5 M MgCl<sub>2</sub>||&nbsp;&nbsp;0.42 mL
 +
|-
 +
|5 M NaCl||20 mL
 +
|-
 +
|Micronutrient stock||&nbsp;&nbsp;0.04 mL
 +
|-
 +
|Autoclaved milliQ H<sub>2</sub>O||77.4 mL
 +
|-
 +
|TOTAL||200 mL
 +
|}
  
 
6. Filter sterilize with 0.2 micron filter<br>
 
6. Filter sterilize with 0.2 micron filter<br>
 
7. Aliquot into sterile plastic bottle and freeze at -20°C.<br>
 
7. Aliquot into sterile plastic bottle and freeze at -20°C.<br>
  
[Micronutrient stock (50 mL)]<br>
+
[ Micronutrient stock (50 mL) ]<br>
Mix everything together in 40 mL autoclaved milliQ H2O, bring up total volume to 50 mL. <br>
+
Mix everything together in 40 mL autoclaved milliQ H<sub>2</sub>O, bring up total volume to 50 mL. <br>
 
Store at room temperature.<br>
 
Store at room temperature.<br>
 +
{| class="wikitable" cellpadding="6"
 +
|<b>Component</b>||<b>Formula</b>||<b>Grams for 50 mL</b>
 +
|-
 +
|ammonium molybdate||(NH<sub>4</sub>)<sub>6</sub>Mo<sub>7</sub>O<sub>24</sub>•4H<sub>2</sub>O||0.009
 +
|-
 +
|boric acid||H<sub>3</sub>BO<sub>3</sub>||0.062
 +
|-
 +
|cobalt chloride||CoCl<sub>2</sub>||0.018
 +
|-
 +
|cupric sulfate||CuSO<sub>4</sub>||0.006
 +
|-
 +
|manganese chloride||MnCl<sub>2</sub>||0.040
 +
|-
 +
|zinc sulfate||ZnSO<sub>4</sub>||0.007
 +
|}
 +
 +
 +
*2-1. Prepare overnight cultures of <partinfo>BBa_K1139201</partinfo>, positive control and negative control, each in MOPS medium (including 1.32 mM K<sub>2</sub>HPO<sub>4</sub>) containing ampicillin (50 µg/mL) at 37°C. <br>
 +
*2-2. Dilute the overnight cultures to an OD600 of 0.1 in fresh MOPS medium (3 mL) containing ampicillin (50 µg/mL). (→fresh cultures) <br>
 +
*2-3. Incubate the fresh cultures until the observed OD600 reaches 0.4-0.6. <br>
 +
*2-4. Centrifuge the cells at 6,000g, 25°C, 10 minutes. Wash twice with MOPS minimal medium without phosphate containing ampicillin (50 µg/mL). Then suspend the cells in the same medium to obtain a final OD600 of 10. <br>
 +
*2-5. Add 300 µL of prepared cell suspension to 2.7 mL of test solution, the series of phosphate concentration gradient 1X MOPS, containing ampicillin (50 µg/mL) <br>
 +
*2-6. Incubate the cells for 140 minutes at 26°C. <br>
 +
*2-7. 1 mL of each culture was harvested by centrifugation and suspended by adding 1 mL of PBS (phosphate-buffered saline). Dilute the suspension to obtain a final OD600 of around 0.2 by PBS.<br>
 +
*2-8. Dispense 600 µL of each suspension into a disposable tube through a cell strainer. Fluorescence intensity was measured with a flow cytometer of Becton, Dickinson and Company.<br>
 +
 +
===Results===
 +
<b>1. Before inducing by phosphate concentration</b><br>
 +
Fig. 2.1 shows the fluorescence intensity of the fresh cultures (the MOPS medium which contains 1.32 mM K<sub>2</sub>HPO<sub>4</sub>) incubated until the observed OD600 reached 0.4-0.6 (Assay protocol 1-2-3). The <i>phoA</i> promoter was repressed because the MOPS medium contained 1.32 mM phosphate, which was a high concentration for <i>phoA</i> promoter.<br>
  
[[Image:Titech2013_parts_K1139201_EX_Tab5.jpg|frameless|left|500px|]]<br>
+
[[Image:titech2013_parts_K1139201_exp_Fig2-1.jpg|thumb|center|360px|<b>Fig. 2.1.</b> Fluorescence intensity of the fresh cultures]]
  
 +
<b>2. After inducing by phosphate concentration</b><br>
 +
Fig. 2-2 and Fig. 2-3 show the fluorescence intensity of the induced cells by phosphate concentration. In Fig. 2-2, we saw that the <i>phoA</i> promoter was repressed by high phosphate concentrations, while the constitutive promoter did not show any significant change. Fig. 2-3 also proved that the increase in phosphate concentration repressed the <i>phoA</i> promoter. Fig. 2-4 shows the picture of fluorescence of the induced cells. Especially, we confirmed that the <i>phoA</i> promoter was drastically repressed at phosphate concentrations of 100 to 200 µM.<br>
  
*1-2-1. Prepare overnight culture of BBa_K1139201, positive control and negative control, each in MOPS medium (including 1.32 mM K<small>2</small>HPO<small>4</small>) containing ampicillin (50 µg/mL) at 37°C. <br>
+
[[Image:titech2013_parts_K1139201_exp_Fig2-2.jpg|thumb|center|360px|<b>Fig. 2-2.</b> Fluorescence intensity of the induced cells (with positive and negative controls)]]
*1-2-2. Dilute the overnight cultures to an OD600 of 0.1 in fresh MOPS medium (3 mL) containing ampicillin (50 µg/mL). (→fresh cultures) <br>
+
*1-2-3. Incubate the fresh cultures until the observed OD600 reaches 0.4-0.6. <br>
+
*1-2-4. Centrifuge the cells at 6000g, 25°C, 10 minutes, wash twice with MOPS minimal medium without phosphate containing ampicillin (50 µg/mL), and then suspend in the same medium to obtain a final OD600 of 10. <br>
+
*1-2-5. Add 300 µL of prepared cell suspension to 2.7 mL of test solution, the series of phosphate concentration gradient 1 X MOPS, containing ampicillin (50 µg/mL) <br>
+
*1-2-6. Incubate the cells for 140 minutes at 26°C. <br>
+
*1-2-7. 1 mL of each culture was harvested by centrifugation and suspended by adding 1 mL of PBS (phosphate-buffered saline). Dilute the suspension to obtain a final OD600 of around 0.2 by PBS.<br>
+
*1-2-8. Dispense 600 µL of each suspension into a disposable tube through a cell strainer. Fluorescence intensity was measured with a flow cytometer of Becton, Dickinson and Company.<br>
+
  
==2. Results==
+
[[Image:titech2013_parts_K1139201_exp_Fig2-3.jpg|thumb|center|360px|<b>Fig. 2-3.</b> Fluorescence intensity of the induced cells of <partinfo>BBa_K1139201</partinfo>]]
'''2-1. Before inducing by phosphate concentration'''
+
Fig. 2.1 shows the fluorescence intensity of the fresh cultures (the MOPS medium which contains 1.32 mM K<small>2</small>HPO<small>4</small>) incubated until the observed OD600 reached 0.4-0.6 (Assay protocol 2-2-3). ''phoA'' promoter was repressed because the MOPS medium contained 1.32 mM phosphate, which was a high concentration for ''phoA'' promoter.
+
  
[[Image:Titech2013_parts_K1139201_EX_Fig2-1.jpg|thumb|center|500px|'''Fig. 2.1.''' Fluorescence intensity of the fresh cultures]]<br>
+
[[Image:titech2013_parts_K1139201_exp_Fig2-4.jpg|thumb|center|360px|<b>Fig. 2-4.</b> Picture of fluorescence of the induced cells]]
  
'''2-2. After inducing by phosphate concentration'''
+
===Discussion===
Fig. 2.2.1 shows the fluorescence intensity of the induced cells by phosphate concentration. Fig. 2.2.2 shows the picture of fluorescence of the induced cells. The increase in phosphate concentration repressed the ''phoA'' promoter. Especially, we saw that the ''phoA'' promoter was drastically repressed at phosphate concentrations of 100 to 300 µM.
+
We confirmed that the increase in phosphate concentration repressed the <i>phoA</i> promoter and succeeded in improving the phosphate sensor part.
 +
Though OUC-China 2012 reported a phosphate sensor part including the <i>phoB</i> promoter (<partinfo>BBa_K737024</partinfo>), their part did not have sufficient data for us. Their assay data (Fig. 3-1, converted to bar chart) did not show significant change in RFU (relative fluorescent unit) in response to phosphate concentrations. The positive and the negative control were not shown. Their references for constructing and assaying the part were not clear, either. In addition, we found some mutations (substitution and deletion) in their part through analyzing the DNA sequence (Fig. 3-2).<br>
  
[[Image:Titech2013_parts_K1139201_EX_Fig2-1-1.jpg|thumb|center|500px|'''Fig. 2.1.1''' Fluorescence intensity of the induced cells]]<br>
+
[[Image:titech2013_parts_K1139201_exp_Fig3-1.jpg|thumb|center|300px|<b>Fig. 3-1.</b> OUC-China 2012's <i>phoB</i> promoter assay result reported by them (converted to bar chart)]]
 +
[[Image:titech2013_parts_K1139201_exp_Fig3-2.jpg|thumb|center|300px|<b>Fig. 3-2.</b> Mutations found in OUC-China's phosphate sensor part]]
  
[[Image:Titech2013_parts_K1139201_EX_Fig2-1-2.jpg|thumb|center|500px|'''Fig. 2.1.2''' Picture of fluorescence of the induced cells]]<br>
+
We assayed OUC-China's phosphate sensor part by the same method as that for our <i>phoA</i> promoter assay since we thought that the phoB promoter should also be repressed by high phosphate concentrations. According to previous reports, the regulation of the <i>phoB</i> promoter is similar to that of the <i>phoA</i> promoter (Shinagawa et al., 1983). The result of this assay (Fig. 3-4, enlarged view in Fig. 3-5) shows clearly that their part did not respond to the increase in phosphate concentration compared to our part including the <i>phoA</i> promoter (Fig. 3-3). Therefore, we hypothesize that the mutations have something to do with the activity of the <i>phoB</i> promoter.
 +
Thus, we conclude that we improved the phosphate sensor part. Our part can be useful not only for our project but also for various studies in synthetic biology.
  
==3. Discussion==
+
<gallery widths="350px" heights="250px" style="margin-left:auto; margin-right:auto; text-align: center;">
We confirmed that the increase in phosphate concentration repressed the ''phoA'' promoter. Compared to OUC-China’s phosphate sensor part (<partinfo>BBa_K737024</partinfo>) including ''phoB'' promoter (Fig. 3.2), our phosphate sensor part shows clearer result.
+
Image:titech2013_parts_K1139201_exp_Fig3-3.jpg|<b>Fig. 3-3.</b> Our induction assay result for our <i>phoA</i> promoter
 +
Image:titech2013_parts_K1139201_exp_Fig3-4.jpg|<b>Fig. 3-4.</b> Our induction assay result for OUC-China 2012's <i>phoB</i> promoter
 +
</gallery>
  
[[Image:Titech2013_parts_K1139201_EX_Fig3-1.jpg|thumb|left|500px|'''Fig. 3.1''' Our ''phoA'' promoter assay result]]
+
<br>
  
[[Image:Titech2013_parts_K1139201_EX_Fig3-2.jpg|thumb|left|500px|'''Fig. 3.2''' OUC-China 2012’s ''phoB'' promoter assay result (converted to bar chart)]]<br>
+
[[Image:titech2013_parts_K1139201_exp_Fig3-5.jpg|thumb|center|300px|<b>Fig. 3-5.</b> Enlarged view of Fig. 3-4]]
  
Moreover, plants are reported to be in phosphate starvation under the concentration of 1 mM (D. Hoagland et al., 1950). Our part can also sense the concentration below 1 mM. Therefore, this part will lead us to our goal to create ''E. coli'' which could increase plant growth by synthesizing several plant hormones depending on the soil environment.
 
  
 +
For more information, see [http://2013.igem.org/Team:Tokyo_Tech/Experiment/phoA_Promoter_Assay our work in Tokyo_Tech 2013 wiki].
  
 
===Applications of BBa_K1139201===
 
===Applications of BBa_K1139201===

Latest revision as of 21:03, 28 October 2013

PphoA-GFP-TT

Materials and Methods

1. Construction
-pSB6A1-Ptet-GFP (MG1655)… positive control
-pSB6A1-ΔP-GFP (MG1655)… negative control
-pSB6A1-PphoA-GFP (MG1655)…BBa_K1139201

The phoA promoter region of E. coli was amplified from MG1655 genomic DNA by PCR using upstream primer (5’-acgtgaattcgcggccgcttctagagaaagttaatcttttcaacagctgtcataaag-3’) and downstream primer (5’-ccgctactagtaaatacattaaaaaataaaaacaaagcgactataagtctc-3’). Amplification was carried out with the steps shown in Fig. 1.

Fig. 1. Steps for PCR of the phoA promoter

2. Assay Protocol

  • 2-0. Prepare MOPS minimal medium as follows (Neidhardt et al., 1974).

Also, prepare a series of phosphate concentration gradient 1X MOPS by changing the volume of K2HPO4 (We prepared the series as 0, 10, 30, 50, 100, 150, 200, 250, 300, 500, 1000 µM).

[ Prepare MOPS minimal medium ]
200 mL of 1X MOPS is prepared as follows.

Component Volume
10X MOPS mixture   20 mL
0.132 M K2HPO4     2 mL
milliQ H2O 176 mL
TOTAL 200 mL

1. Mix ingredients above and adjust the pH to 7.2 with 5 M NaOH.
2. Filter sterilize. It can be stored at 4°C, for up to 1 month.
3. Before use, add carbon source (we used a final concentration of 0.1% glucose).

[ 10X MOPS mixture (200 mL) ]
1. Add the following to ~60 mL milliQ H2O:

Component Grams
MOPS 16.7
Tricine   1.43

2. Add 5 M KOH to a final pH of 7.4
3. Bring total volume to 88 mL
4. Make fresh FeSO4 solution and add it to the MOPS/Tricine solution:

Component Volume
0.01 M FeSO4•7H2O 2 mL

5. Add the following solutions to the MOPS/Tricine/FeSO4 solution
(Mix in the order shown)

Component Volume
1.9 M NH4Cl 10 mL
0.276 M K2SO4   2 mL
0.02 M CaCl2•H2O   0.05 mL
2.5 M MgCl2   0.42 mL
5 M NaCl 20 mL
Micronutrient stock   0.04 mL
Autoclaved milliQ H2O 77.4 mL
TOTAL 200 mL

6. Filter sterilize with 0.2 micron filter
7. Aliquot into sterile plastic bottle and freeze at -20°C.

[ Micronutrient stock (50 mL) ]
Mix everything together in 40 mL autoclaved milliQ H2O, bring up total volume to 50 mL.
Store at room temperature.

Component Formula Grams for 50 mL
ammonium molybdate (NH4)6Mo7O24•4H2O 0.009
boric acid H3BO3 0.062
cobalt chloride CoCl2 0.018
cupric sulfate CuSO4 0.006
manganese chloride MnCl2 0.040
zinc sulfate ZnSO4 0.007


  • 2-1. Prepare overnight cultures of BBa_K1139201, positive control and negative control, each in MOPS medium (including 1.32 mM K2HPO4) containing ampicillin (50 µg/mL) at 37°C.
  • 2-2. Dilute the overnight cultures to an OD600 of 0.1 in fresh MOPS medium (3 mL) containing ampicillin (50 µg/mL). (→fresh cultures)
  • 2-3. Incubate the fresh cultures until the observed OD600 reaches 0.4-0.6.
  • 2-4. Centrifuge the cells at 6,000g, 25°C, 10 minutes. Wash twice with MOPS minimal medium without phosphate containing ampicillin (50 µg/mL). Then suspend the cells in the same medium to obtain a final OD600 of 10.
  • 2-5. Add 300 µL of prepared cell suspension to 2.7 mL of test solution, the series of phosphate concentration gradient 1X MOPS, containing ampicillin (50 µg/mL)
  • 2-6. Incubate the cells for 140 minutes at 26°C.
  • 2-7. 1 mL of each culture was harvested by centrifugation and suspended by adding 1 mL of PBS (phosphate-buffered saline). Dilute the suspension to obtain a final OD600 of around 0.2 by PBS.
  • 2-8. Dispense 600 µL of each suspension into a disposable tube through a cell strainer. Fluorescence intensity was measured with a flow cytometer of Becton, Dickinson and Company.

Results

1. Before inducing by phosphate concentration
Fig. 2.1 shows the fluorescence intensity of the fresh cultures (the MOPS medium which contains 1.32 mM K2HPO4) incubated until the observed OD600 reached 0.4-0.6 (Assay protocol 1-2-3). The phoA promoter was repressed because the MOPS medium contained 1.32 mM phosphate, which was a high concentration for phoA promoter.

Fig. 2.1. Fluorescence intensity of the fresh cultures

2. After inducing by phosphate concentration
Fig. 2-2 and Fig. 2-3 show the fluorescence intensity of the induced cells by phosphate concentration. In Fig. 2-2, we saw that the phoA promoter was repressed by high phosphate concentrations, while the constitutive promoter did not show any significant change. Fig. 2-3 also proved that the increase in phosphate concentration repressed the phoA promoter. Fig. 2-4 shows the picture of fluorescence of the induced cells. Especially, we confirmed that the phoA promoter was drastically repressed at phosphate concentrations of 100 to 200 µM.

Fig. 2-2. Fluorescence intensity of the induced cells (with positive and negative controls)
Fig. 2-3. Fluorescence intensity of the induced cells of BBa_K1139201
Fig. 2-4. Picture of fluorescence of the induced cells

Discussion

We confirmed that the increase in phosphate concentration repressed the phoA promoter and succeeded in improving the phosphate sensor part. Though OUC-China 2012 reported a phosphate sensor part including the phoB promoter (BBa_K737024), their part did not have sufficient data for us. Their assay data (Fig. 3-1, converted to bar chart) did not show significant change in RFU (relative fluorescent unit) in response to phosphate concentrations. The positive and the negative control were not shown. Their references for constructing and assaying the part were not clear, either. In addition, we found some mutations (substitution and deletion) in their part through analyzing the DNA sequence (Fig. 3-2).

Fig. 3-1. OUC-China 2012's phoB promoter assay result reported by them (converted to bar chart)
Fig. 3-2. Mutations found in OUC-China's phosphate sensor part

We assayed OUC-China's phosphate sensor part by the same method as that for our phoA promoter assay since we thought that the phoB promoter should also be repressed by high phosphate concentrations. According to previous reports, the regulation of the phoB promoter is similar to that of the phoA promoter (Shinagawa et al., 1983). The result of this assay (Fig. 3-4, enlarged view in Fig. 3-5) shows clearly that their part did not respond to the increase in phosphate concentration compared to our part including the phoA promoter (Fig. 3-3). Therefore, we hypothesize that the mutations have something to do with the activity of the phoB promoter. Thus, we conclude that we improved the phosphate sensor part. Our part can be useful not only for our project but also for various studies in synthetic biology.


Fig. 3-5. Enlarged view of Fig. 3-4


For more information, see [http://2013.igem.org/Team:Tokyo_Tech/Experiment/phoA_Promoter_Assay our work in Tokyo_Tech 2013 wiki].

Applications of BBa_K1139201

User Reviews

UNIQ9cb5985748aff470-partinfo-00000006-QINU UNIQ9cb5985748aff470-partinfo-00000007-QINU