Difference between revisions of "Part:BBa K1139201"

Latest revision as of 23:36, 27 October 2020

PphoA-GFP-TT

PphoA is a promoter that is activated by PhoB-phosphorylated when phosphate concentration is low. GFP is a reporter.

We improved a phosphate sensor part since the existing phosphate sensor part (OUC-China 2012, BBa_K737024) did not have sufficient data.

We constructed this improved part (Fig. 1) by amplifying the phoA promoter region of E. coli (MG1655) and ligating this phoA promoter (BBa_K1139200) upstream of the promoterless GFP generator (BBa_I751310). This phoA promoter is the inducible promoter of the alkaline phosphatase gene (phoA) derived from E. coli (Dollard et al., 2003). This promoter is repressed by high phosphate concentrations (Shinagawa et al., 1983; Hsieh et al., 2010) (Fig. 2).

Fig. 1. Our improved part: BBa_K1139201

Fig. 2. Regulation of the phoA promoter

By an induction assay, this part was confirmed to be repressed by the increase in phosphate concentration.

Compared to OUC-China’s phosphate sensor part including the phoB promoter (Fig. 4), our phosphate sensor part showed a clearer result (Fig. 3) (Note that the scales of the vertical axis are different between the two results).

• 

  Fig. 3. Our induction assay result for our phoA promoter

• 

  Fig. 4. Our induction assay result for OUC-China 2012's phoB promoter

From our results above, we determined parameters for the induction mechanism by fitting the results to the following Hill equation (Fig. 5). α denotes the maximum GFP expression rate in this construct. m denotes the phosphate concentration at which the GFP expression rate is half of α. β denotes the hill coefficient. Those parameters (Tab. 1) can be used in future modeling.

Plants are reported to be in phosphate starvation when its concentration is below 1 mM (Hoagland et al., 1950). Our part can sense the concentration below 1 mM, too (Fig. 6). Therefore, we believe our improved part can be applied to agricultural field. For instance, we have a future plan to create E. coli that could increase plant growth by synthesizing several plant hormones depending on the soil environment.

Fig. 5. Equation for the induction mechanism

Tab. 1. Determined parameters
α　denotes the maximum GFP expression rate in this construct.
m denotes the phosphate concentration at which the GFP expression rate is half of α.
β denotes the hill coefficient.

The result of our model is shown in Fig. 6.

Fig. 6. A model with fitting the results of our assay

For more information, see [http://2013.igem.org/Team:Tokyo_Tech/Experiment/phoA_Promoter_Assay our work in Tokyo_Tech 2013 wiki].

Team UFlorida's Contribution (2020)

In the absence of a lab, The University of Florida 2020 iGEM team offers literature to further understand and improve part BBa_K1139201. To increase the expression of part BBa_K1139201 designed by iGem Tokyo 2013 Team, and sfGFP proteins of future iGEM projects, the RiboJ insulator sequence can be added between the pPhoA promoter and the downstream sequences (Part BBa_K1139201 with insulator ). Insulators protect against unexpected interactions between neighboring sequences in a genetic circuit (Clifton 2). A common insulator, RiboJ, is made up of the sTRSV-ribozyme, along with a subsequent 23-nucleotide hairpin sequence (Luo 3). The hairpin structure helps expose the ribosome binding site, so that translation can be increased for the downstream sequence transcripts (Luo 3). Therefore, insulators, and specifically, the RiboJ sequence, can be used to increase the efficacy of gene and protein expression in future experimental genetic constructs.

The results from the Department of Biology at the College of William and Mary show greater absolute sfGFP fluorescence was observed in the promoter construct insulated with the RiboJ sequence, as compared to the promoter without RiboJ insulation (Clifton 4). It was determined from this experiment that using a RiboJ insulator within the composite part construct leads to increased sfGFP protein expression and higher concentration of mRNA transcripts (Clifton 4).

Figure 1. Each dot represents the average fluorescence value of a sample size greater than 10,000 cells. The blue dots represent the absolute fluorescence of the construct including the RiboJ insulator, while the black dots represent the absolute fluorescence of the construct without the RiboJ sequence. The x-axis is labeled with the names of the BioBrick constructs used in this experiment. As seen in the graph from the Journal of Biological Engineering, RiboJ insulator increased the expression of sfGFP protein, which resulted in greater mean absolute fluorescence values for each BioBrick construct (Clifton 4).

Figure 2. This experiment by Clifton, Jones, et al., compared the protein expression levels of 24 constitutive promoters, some of which contained the RiboJ insulator sequence and others that did not. The only difference between a promoter and its paired construct was the presence of added RiboJ insulator sequence. As seen in the graph on the right, as published in the Journal of Biological Engineering, the blue column represents the constitutive promoters that included the RiboJ sequence, while the gray column represents the promoters without the addition of RiboJ (Clifton). When comparing the mRNA and protein expression of these promoters, it was determined in the Journal of Biological Engineering that RiboJ insulators increase the expression levels of the constructs (Clifton).

RiboJ insulator DNA sequence (Meyer 4): AGCTGTCACCGGATGTGCTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGCCTCTACAAATAATTTTGTTTAA

Including the DNA sequence (listed above) between the pPhoA and the subsequent genes in Part BBa_K1139201 can increase the expression of sfGFP protein in this specific part, but also in future iGEM experiments that involve the quantification of absolute fluorescence as the output of an experimental design.

Sequence and Features