Difference between revisions of "Part:BBa K1065203:Design"

(→‎Source)
(→‎References)
 
(3 intermediate revisions by the same user not shown)
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1065203 short</partinfo>
 
<partinfo>BBa_K1065203 short</partinfo>
Line 10: Line 9:
  
 
<html>
 
<html>
−
The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br />
+
The construct has been builded with a standard assembly.
 +
We firstly optimized the codons of EFE gene for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br />
 
<br />
 
<br />
 
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
 
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
Line 18: Line 18:
  
 
===Source===
 
===Source===
−
 
+
The coding sequence of EFE gene was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2.
 
We used a CDS optimized for both ''E. coli'' and'' B. subtilis'' that was synthesized by Genescript.
 
We used a CDS optimized for both ''E. coli'' and'' B. subtilis'' that was synthesized by Genescript.
  
 
===References===
 
===References===
 +
<html><ol>
 +
<li>Goto M, Shiday I, Akitaway T, Hyodoh, (1985). Ethylene production by the Kudzu strains of <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.</li>
 +
<li>Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Journal of General Microbiology 137: 2281–2286.</li>
 +
<li>Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Biochem Biophys Res Commun 188: 826–832.</li>
 +
<li>Guerrero F, Carbonell. V., Cossu M, Correddu D, Jones PR (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in <I>Synechocystis sp.</I> PCC 6803. PLoS ONE 7(11): e50470.</li>
 +
<li> http://www.ncbi.nlm.nih.gov/pubmed/11728721, Joseph ''et al.''</li>
 +
</ol></html>
 +
 +
<!-- Uncomment this to enable Functional Parameter display
 +
===Functional Parameters===
 +
<partinfo>BBa_K1065000 parameters</partinfo>
 +
<!-- -->

Latest revision as of 09:25, 1 October 2013

Efe+Bba_B0015 in pSpac (BBa_K823026)


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal prefix found in sequence at 9491
    Illegal suffix found in sequence at 1224
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal EcoRI site found at 9491
    Illegal SpeI site found at 1225
    Illegal PstI site found at 1239
    Illegal NotI site found at 1232
    Illegal NotI site found at 9497
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal EcoRI site found at 9491
    Illegal BglII site found at 319
    Illegal BglII site found at 7085
    Illegal BamHI site found at 2601
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal prefix found in sequence at 9491
    Illegal suffix found in sequence at 1225
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal prefix found in sequence at 9491
    Illegal XbaI site found at 9506
    Illegal SpeI site found at 1225
    Illegal PstI site found at 1239
    Illegal NgoMIV site found at 17
    Illegal NgoMIV site found at 4148
    Illegal AgeI site found at 1070
    Illegal AgeI site found at 6696
    Illegal AgeI site found at 7658
    Illegal AgeI site found at 8333
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 3972
    Illegal BsaI.rc site found at 5411
    Illegal BsaI.rc site found at 7927
    Illegal SapI site found at 2889
    Illegal SapI.rc site found at 6909


Design Notes

The construct has been builded with a standard assembly. We firstly optimized the codons of EFE gene for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.

GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...

...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG

Source

The coding sequence of EFE gene was taken from Pseudomonas syringae pv. phaseolicola PK2. We used a CDS optimized for both E. coli and B. subtilis that was synthesized by Genescript.

References

  1. Goto M, Shiday I, Akitaway T, Hyodoh, (1985). Ethylene production by the Kudzu strains of Pseudomonas syringae pv. phaseolicola causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.
  2. Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from Pseudomonas syringae pv. phaseolicola PK2. Journal of General Microbiology 137: 2281–2286.
  3. Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem Biophys Res Commun 188: 826–832.
  4. Guerrero F, Carbonell. V., Cossu M, Correddu D, Jones PR (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in Synechocystis sp. PCC 6803. PLoS ONE 7(11): e50470.
  5. http://www.ncbi.nlm.nih.gov/pubmed/11728721, Joseph ''et al.''