Difference between revisions of "Part:BBa K1065000:Design"

(→‎Design Notes)
(→‎References)
 
(11 intermediate revisions by 2 users not shown)
Line 9: Line 9:
  
 
<html>
 
<html>
−
Ethylene-forming enzyme that catalyses the formation of ethylene from 2-oxoglutarate. The coding sequence was taken from <I>Pseuhmonas syringa</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>b.Subtilis</I> and <I>e.Coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br/>
+
The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br />
−
 
+
<br />
−
<span style= "color:yellow" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
+
Move the mouse over the sequences to see the features.
 +
<br/><br/>
 +
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
 
<br/>
 
<br/>
 
...TCG<span  style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span>
 
...TCG<span  style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span>
−
 
 
</html>
 
</html>
  
 
===Source===
 
===Source===
  
−
xxxx
+
Synthesized by GenScript®.
  
 
===References===
 
===References===
 +
<html><ol>
 +
<li>Goto M, Shiday I, Akitaway T, Hyodoh, (1985). Ethylene production by the Kudzu strains of <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.</li>
 +
<li>Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Journal of General Microbiology 137: 2281–2286.</li>
 +
<li>Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Biochem Biophys Res Commun 188: 826–832.</li>
 +
<li>Guerrero F, Carbonell. V., Cossu M, Correddu D, Jones PR (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in <I>Synechocystis sp.</I> PCC 6803. PLoS ONE 7(11): e50470.</li>
 +
</ol></html>

Latest revision as of 13:47, 20 September 2013


2-oxoglutarate oxygenase/decarboxylase (EFE)


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 319
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 17
    Illegal AgeI site found at 1070
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The coding sequence was taken from Pseudomonas syringae pv. phaseolicola PK2. We firstly optimized the codons for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.

Move the mouse over the sequences to see the features.

GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...

...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG

Source

Synthesized by GenScript®.

References

  1. Goto M, Shiday I, Akitaway T, Hyodoh, (1985). Ethylene production by the Kudzu strains of Pseudomonas syringae pv. phaseolicola causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.
  2. Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from Pseudomonas syringae pv. phaseolicola PK2. Journal of General Microbiology 137: 2281–2286.
  3. Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem Biophys Res Commun 188: 826–832.
  4. Guerrero F, Carbonell. V., Cossu M, Correddu D, Jones PR (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in Synechocystis sp. PCC 6803. PLoS ONE 7(11): e50470.