Difference between revisions of "Part:BBa K875020"
Line 4: | Line 4: | ||
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose. | This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose. | ||
− | This composite part is developed | + | This composite part is developed from previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers: |
β-Glucosidase_Fw | β-Glucosidase_Fw |
Latest revision as of 16:33, 26 September 2012
β-Glucosidase
This part is composed by J23100-B0034-β-glucosidase-B0015. When this part is expressed in bacteria, they become able to metabolize cellobiose converting it in two molecules of glucose.
This composite part is developed from previous work by UNITS iGEM team 2011 and Edinburgh team 2011. They discovered that BBa_K392008 (Osaka 2010), coding for a Cellumonas fimi β-glucosidase, possess an apparent frameshift near the start of the coding sequence. The coding sequence has now been determined to start from an ATG located 220 bp downstream of the reported one. We therefore decided to correct the Bba_K392008 in order to have the correct coding sequence. In order to do this we made a PCR on Bba_K392008 by using the following primers:
β-Glucosidase_Fw
GCATGAATTCGCGGCCGCTTCTAGATGACCACCACGCGCCCCTC
β-Glucosidase_Rev
GCATCTGCAGCGGCCGCTACTAGTATCAGGGCTGGTAGGTCGCGG
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30 - 21INCOMPATIBLE WITH RFC[21]Illegal XhoI site found at 920
Illegal XhoI site found at 1154 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 407
Illegal AgeI site found at 303
Illegal AgeI site found at 498 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 280