Difference between revisions of "Part:BBa K823029"

 
(4 intermediate revisions by the same user not shown)
Line 2: Line 2:
 
<partinfo>BBa_K823029 short</partinfo>
 
<partinfo>BBa_K823029 short</partinfo>
  
mKate2 is a far-red fluorescent protein that is monomeric and extremely photostable. It is in Freiburg standard and has a RBS included with the correct spacing.
+
[[Image:LMU-Munich-MKate Pellet.JPG|<p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), P<sub>''liaI''</sub> (middle) and [https://parts.igem.org/Part:BBa_K823002 P<sub>''lepA''</sub>] (down) in [https://parts.igem.org/Part:BBa_K8230023 pSB<sub>''Bs''</sub>1C]'''. Pellets are ''Escherichia coli'' cells which contain the plasmid with the right insert.</p>|thumb|300px|right]]mKate2 is a far-red fluorescent protein that is monomeric and extremely photostable. It is in Freiburg standard and has a RBS included with the correct spacing.
 +
 
 +
Find out more about the design of our [https://static.igem.org/mediawiki/parts/b/b9/LMU-Munich_2012_Our_Freiburg_standard_FusionPrefix.pdf prefix with ribosome binding site].
  
 
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
 
prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC
Line 12: Line 14:
 
Emission maximum: 633 nm
 
Emission maximum: 633 nm
  
[[Image:LMU-Munich-MKate Pellet.JPG|<p align="justify">'''''mKate2'' fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), P<sub>''liaI''</sub> (middle) and [https://parts.igem.org/Part:BBa_K823002 P<sub>''lepA''</sub>] (down) in [https://parts.igem.org/Part:BBa_K8230023 pSB<sub>''Bs''</sub>1C]'''. Pellets are ''Escherichia coli'' cells which contain the plasmid with the right insert.</p>|thumb|300px|left]]
 
<p align="justify">We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters [https://parts.igem.org/Part:BBa_K823001 P<sub>''liaI''</sub>], P<sub>''lepA''</sub> and the Anderson promoter J23101 in the empty ''Bacillus'' vector pSB<sub>''Bs''</sub>1C from our '''''Bacillus''B'''io'''B'''rick'''B'''ox. At the moment we have the right clones of ''B. subtilis'' with the integrated construct. Unfortunately we have no equipment to measure this reporter. Neither our plate reader nor the fluorescent microscope has the required filters.</p>
 
  
 +
<p align="justify">We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters [https://parts.igem.org/Part:BBa_K823001 P<sub>''liaI''</sub>], P<sub>''lepA''</sub> and the Anderson promoter [https://parts.igem.org/Part:BBa_K823005 J23101] in the empty ''Bacillus'' vector [https://parts.igem.org/Part:BBa_K823023 pSB<sub>''Bs''</sub>1C] from our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''Bacillus''B'''io'''B'''rick'''B'''ox]. At the moment we have the right clones of ''B. subtilis'' with the integrated construct. Unfortunately we have no equipment to measure this reporter. Neither our plate reader nor the fluorescent microscope have the required filters.</p>
  
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===

Latest revision as of 08:54, 26 September 2012

mKate2, a red monomeric fluorescent protein, B. subtilis optimized

mKate2 fused to the terminator B0014 under the control of the Anderson promoter J23101 (up), PliaI (middle) and PlepA (down) in pSBBs1C. Pellets are Escherichia coli cells which contain the plasmid with the right insert.

mKate2 is a far-red fluorescent protein that is monomeric and extremely photostable. It is in Freiburg standard and has a RBS included with the correct spacing.

Find out more about the design of our prefix with ribosome binding site.

prefix: GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix: ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

Excitation maximum: 588 nm

Emission maximum: 633 nm


We cloned this reporter in front of the terminator B0014. For the evaluation this reporter was successfully combined with the promoters PliaI, PlepA and the Anderson promoter J23101 in the empty Bacillus vector pSBBs1C from our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox]. At the moment we have the right clones of B. subtilis with the integrated construct. Unfortunately we have no equipment to measure this reporter. Neither our plate reader nor the fluorescent microscope have the required filters.





Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 4
  • 1000
    COMPATIBLE WITH RFC[1000]