Difference between revisions of "Part:BBa K883000"

 
(4 intermediate revisions by 3 users not shown)
Line 2: Line 2:
 
<partinfo>BBa_K883000 short</partinfo>
 
<partinfo>BBa_K883000 short</partinfo>
  
CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in ''Escherichia coli'', these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBak883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications
+
CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in ''Escherichia coli'', these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. [https://parts.igem.org/Part:BBa_K883001 BBa_K883001]) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications
 +
 
 +
 
 +
===Usage and Biology===
  
 
We obtained the coding sequence in a pET28 vector from the Virology group of Wageningen UR, where Dr. Kormelink helped us by providing us with this vector. To make the sequence compatible with the Registry of Standard Biological Parts, we designed the following primers to amplify the coat protein sequence out of the pET28 vector.
 
We obtained the coding sequence in a pET28 vector from the Virology group of Wageningen UR, where Dr. Kormelink helped us by providing us with this vector. To make the sequence compatible with the Registry of Standard Biological Parts, we designed the following primers to amplify the coat protein sequence out of the pET28 vector.
Line 14: Line 17:
 
5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTACT'''TCACTAATACACCGGAGTGAAA'''-3’
 
5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTACT'''TCACTAATACACCGGAGTGAAA'''-3’
  
the bold sequence is the sequence part that is complementairy to the CCMV part, and when other pre- or suffix are required, these parts should be included in the new primers.
+
the bold sequence is the sequence part that is complementairy to the CCMV part, and when other pre- or suffix are required, these sequences should be included in the new primers.
  
THis part is used in the construct of part BBa_K883001 so that the protein is IPTG inducable.
+
This Biobrick part is used in the construct of [https://parts.igem.org/Part:BBa_K883001 BBa_K883001] so that the protein is IPTG inducable.
  
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
  
 
<!-- -->
 
<!-- -->
Line 30: Line 31:
 
<partinfo>BBa_K883000 parameters</partinfo>
 
<partinfo>BBa_K883000 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
== *Safety notice* ==
 +
 +
This part is isolated from a virus and, when assembled, will form particles that very much resemble this virus in size and shape. However, no additional viral information is stored in this part and viral infection and/or replication can therefore be ruled out. It is completely safe for use in normal laboratory circumstances.

Latest revision as of 11:02, 26 September 2012

CCMV wt coat protein coding

CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in Escherichia coli, these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBa_K883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications


Usage and Biology

We obtained the coding sequence in a pET28 vector from the Virology group of Wageningen UR, where Dr. Kormelink helped us by providing us with this vector. To make the sequence compatible with the Registry of Standard Biological Parts, we designed the following primers to amplify the coat protein sequence out of the pET28 vector.

prefix – start codon - CCMV forward primer

5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGGTACAGTCGGAACAGG-3’

suffix – CCMV reverse primer

5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTACTTCACTAATACACCGGAGTGAAA-3’

the bold sequence is the sequence part that is complementairy to the CCMV part, and when other pre- or suffix are required, these sequences should be included in the new primers.

This Biobrick part is used in the construct of BBa_K883001 so that the protein is IPTG inducable.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 142
  • 1000
    COMPATIBLE WITH RFC[1000]


*Safety notice*

This part is isolated from a virus and, when assembled, will form particles that very much resemble this virus in size and shape. However, no additional viral information is stored in this part and viral infection and/or replication can therefore be ruled out. It is completely safe for use in normal laboratory circumstances.