Difference between revisions of "Part:BBa K897720"
 
(12 intermediate revisions by 2 users not shown)
Line 4: Line 4:
 
In order to interfere with the cell division, we synthesize the right antisense fragments with gene silencing effects targeting ftsZ  
 
In order to interfere with the cell division, we synthesize the right antisense fragments with gene silencing effects targeting ftsZ  
 
in E.coli. A vector with paired termini was constructed to constantly express different asRNAs of ftsZ in E.coli,and this part has
 
in E.coli. A vector with paired termini was constructed to constantly express different asRNAs of ftsZ in E.coli,and this part has
−
been found inhibiting cell division considerbly.
+
been found inhibiting cell division considerbly.
 +
 
 +
To fabricate this part, we decided to utilize the FtsZ gene to manipulate the division of E.coli.
 +
 
 +
Cell wall division in E. coli involves a complex series of events with the involvement of at least eight different proteins. One of the first steps in bacterial cell wall division involves the formation of the Z-ring, a circular polymeric structure formed by the cytosolic protein FtsZ.
 +
 
 +
FtsZ is a prokaryotic homologue of  andα- andβ-tubulin in E.coli. And like tubulin, it conducts GTPase and polymerization activities in vitro. The exact structure of the Z ring in vivo is not known, but there has been evidence proving that it is highly dynamic, being continuously remodeled, whose frequency is almost proportional to the amount of its GTPase activities . And FtsZ can assemble into the Z-ring without the assistance of any protein so far identified.
 +
 
 +
It has been demonstrated that FtsZ has a precise localization within the bacterium. Immuno-gold electron microscopy showed a diffuse localization in most cells but the Z ring of concentrated FtsZ near the membrane in cells that were about to divide. As division proceeded, the FtsZ ring constricted and remained at the tip of the invaginating membrane.
 +
 
 +
In conclude,  FtsZ is one of the best conserved division proteins in its family and its role in cell division traces back very early in evolution.
 +
 
 +
[[Image:Ftsz-1.jpg|center|500px|]]
 +
 
 +
 
 +
'''The primers of the target FtsZ fragments''' (Template: the complete genome)
 +
 
 +
F:CCGCTCGAGTTTTTATGAGGCCGACGATG
 +
 
 +
R:GCTCTAGAATGTGTTCAACAGCATTACC
 +
 
 +
The restriction sites and the protect sites can be modified.
  
  

Latest revision as of 12:45, 26 September 2012

Antisense FtsZ protected by paired termini structure under T7 promoter

In order to interfere with the cell division, we synthesize the right antisense fragments with gene silencing effects targeting ftsZ in E.coli. A vector with paired termini was constructed to constantly express different asRNAs of ftsZ in E.coli,and this part has been found inhibiting cell division considerbly.

To fabricate this part, we decided to utilize the FtsZ gene to manipulate the division of E.coli.

Cell wall division in E. coli involves a complex series of events with the involvement of at least eight different proteins. One of the first steps in bacterial cell wall division involves the formation of the Z-ring, a circular polymeric structure formed by the cytosolic protein FtsZ.

FtsZ is a prokaryotic homologue of andα- andβ-tubulin in E.coli. And like tubulin, it conducts GTPase and polymerization activities in vitro. The exact structure of the Z ring in vivo is not known, but there has been evidence proving that it is highly dynamic, being continuously remodeled, whose frequency is almost proportional to the amount of its GTPase activities . And FtsZ can assemble into the Z-ring without the assistance of any protein so far identified.

It has been demonstrated that FtsZ has a precise localization within the bacterium. Immuno-gold electron microscopy showed a diffuse localization in most cells but the Z ring of concentrated FtsZ near the membrane in cells that were about to divide. As division proceeded, the FtsZ ring constricted and remained at the tip of the invaginating membrane.

In conclude, FtsZ is one of the best conserved division proteins in its family and its role in cell division traces back very early in evolution.

Ftsz-1.jpg


The primers of the target FtsZ fragments (Template: the complete genome)

F:CCGCTCGAGTTTTTATGAGGCCGACGATG

R:GCTCTAGAATGTGTTCAACAGCATTACC

The restriction sites and the protect sites can be modified.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal XbaI site found at 65
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 261
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal XbaI site found at 65
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal XbaI site found at 65
  • 1000
    COMPATIBLE WITH RFC[1000]