Difference between revisions of "Part:BBa K802005:Design"
(→Source) |
|||
(3 intermediate revisions by one other user not shown) | |||
Line 8: | Line 8: | ||
− | The linker was especially designed to contain the iGem restriction sites in the right order. It was obtained by the hybridization of two primers:<br> | + | <p>The linker was especially designed to contain the iGem restriction sites in the right order. It was obtained by the hybridization of two primers:<br> |
Forward: (5’)aattcgcggccgcttctagagaatactagtagcggccgctgcaga(3’)<br> | Forward: (5’)aattcgcggccgcttctagagaatactagtagcggccgctgcaga(3’)<br> | ||
− | Reverse: (5’)agcttctgcagcggccgctactagtattctctagaagcggccgcg(3’)<br> | + | Reverse: (5’)agcttctgcagcggccgctactagtattctctagaagcggccgcg(3’)<br> |
− | The percentage of the hybridization of the two primers is 91%. The only difference between the two consists in 8 nucleotides: 4 at the 5’end in the case of the Forward primer (which represents the sticky end compatible with a digested HindIII site) and the other 4 at 3’end in the case of the Reverse primer (which represents the sticky end compatible with a digested EcoRI site). | + | </p> |
− | + | ||
− | + | The percentage of the hybridization of the two primers is 91%. The only difference between the two consists in 8 nucleotides: 4 at the 5’end in the case of the Forward primer (which represents the sticky end compatible with a digested HindIII site) and the other 4 at 3’end in the case of the Reverse primer (which represents the sticky end compatible with a digested EcoRI site). | |
===Source=== | ===Source=== | ||
− | The linker was obtained by the hybridization of two synthesized primers. | + | The linker was obtained by the hybridization of two synthesized primers. It was designed for cloning in EcoRI and HindIII sites of the polylinker contained by pUC19 (including the shuttle vectors pHT304 or pHT3015 that also have this linker) |
===References=== | ===References=== |
Latest revision as of 19:15, 26 September 2012
iGEM linker for shuttle vectors BBa_K802003 and BBa_K802004
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
The linker was especially designed to contain the iGem restriction sites in the right order. It was obtained by the hybridization of two primers:
Forward: (5’)aattcgcggccgcttctagagaatactagtagcggccgctgcaga(3’)
Reverse: (5’)agcttctgcagcggccgctactagtattctctagaagcggccgcg(3’)
The percentage of the hybridization of the two primers is 91%. The only difference between the two consists in 8 nucleotides: 4 at the 5’end in the case of the Forward primer (which represents the sticky end compatible with a digested HindIII site) and the other 4 at 3’end in the case of the Reverse primer (which represents the sticky end compatible with a digested EcoRI site).
Source
The linker was obtained by the hybridization of two synthesized primers. It was designed for cloning in EcoRI and HindIII sites of the polylinker contained by pUC19 (including the shuttle vectors pHT304 or pHT3015 that also have this linker)