Difference between revisions of "Part:BBa K733001:Design"
(→Design Note) |
Feisun0718 (Talk | contribs) (→Source) |
||
| (One intermediate revision by the same user not shown) | |||
| Line 1: | Line 1: | ||
===Design Note=== | ===Design Note=== | ||
| − | In order to ease the difficulties we may encounter in amplifying the promoter out directly from ''B. subtilis'' genomic DNA, we design two primers mentioned | + | In order to ease the difficulties we may encounter in amplifying the promoter out directly from ''B. subtilis'' genomic DNA, we design two primers mentioned below. Even when doing the PCR with the two primers, it was hard for us to get pure DNA at the first place. Thus, we tried to run for the thermal cycle for only one time, and use phenol chloroform to purify the DNA. |
===Source=== | ===Source=== | ||
| − | We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter. | + | We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use only one round of denature, annealing and extension to get our intended promoter. |
The sequences of these two primers are: | The sequences of these two primers are: | ||
Latest revision as of 04:53, 24 September 2012
Design Note
In order to ease the difficulties we may encounter in amplifying the promoter out directly from B. subtilis genomic DNA, we design two primers mentioned below. Even when doing the PCR with the two primers, it was hard for us to get pure DNA at the first place. Thus, we tried to run for the thermal cycle for only one time, and use phenol chloroform to purify the DNA.
Source
We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use only one round of denature, annealing and extension to get our intended promoter.
The sequences of these two primers are:
Forward primer: 5’-CATGAAGTCTCCTTGAAATCAGAAGATATTTAGGATATATTTTTCTATGGAT–3’(Prefix not shown)
Reverse primer: 5’–CAATATCCCTTTTATCCATAGAAAAATATATCCTAAATATCT–3’ (Suffix not shown)