Difference between revisions of "Part:BBa K515100:Experience"
(→Applications of BBa_K515100) |
Qiuxinyuan12 (Talk | contribs) |
||
(5 intermediate revisions by the same user not shown) | |||
Line 22: | Line 22: | ||
|}; | |}; | ||
<!-- End of the user review template --> | <!-- End of the user review template --> | ||
+ | |||
+ | |||
+ | {|width='80%' style='border:1px solid gray' | ||
+ | |- | ||
+ | |width='10%'| | ||
+ | <partinfo>BBa_K515100 AddReview 5</partinfo> | ||
+ | <I>NUDT_CHINA 2015</I> | ||
+ | |width='60%' valign='top'| | ||
+ | |||
+ | This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH. | ||
+ | |||
+ | ====Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaH==== | ||
+ | |||
+ | For IAAM | ||
+ | |||
+ | F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’ | ||
+ | |||
+ | R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’ | ||
+ | |||
+ | |||
+ | For IAAH | ||
+ | |||
+ | F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’ | ||
+ | |||
+ | R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’ | ||
+ | |||
+ | ====Two new bio-bricks were designed based on this part using the primers above==== | ||
+ | |||
+ | See BBa_K1789000 and BBa_K1789001 | ||
+ | |||
+ | Both of those parts were sent to the registry. | ||
+ | |}; | ||
+ | |||
+ | |||
<!-- DON'T DELETE --><partinfo>BBa_K515100 EndReviews</partinfo> | <!-- DON'T DELETE --><partinfo>BBa_K515100 EndReviews</partinfo> |
Latest revision as of 16:27, 18 September 2015
Applications of BBa_K515100
- The enzymatic reactions of the IAM pathway produce indole-3 acetic acid (IAA) which is an important phytohormone.
- Many Plant Growth Promoting Rhizobacteria produce IAA
- Analogues of phytohormones like α-Naphthaleneacetic acid are usually found in rooting powders. Therefore, if we were to express IAA in bacteria in a controlled fashion we could increase root growth.
- Increased root growth could help maintain top soil.
- Evidence has shown that using IAA on cotton can increase yields.
User Reviews
UNIQa3b39bbef62f3986-partinfo-00000001-QINU
•••••
NUDT_CHINA 2015 |
This part is the only one available with IAAM and IAAH , but unfortunately, we noticed that neither of the CDS of those two enzyme were submitted to the registry (they were only registered as BBa_K515000 and K515001). Thus, several improvements were made based on the part K515100 to provide an available version of IAAM and IAAH. Two pairs of enzymes that can PCR-prep the CDS of IaaM and IaaHFor IAAM F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGTTTGGACCGG-3’ R-Prime: 5’- GCGGCGGACTAGTCTTATTAGTCCCCCAGCG -3’
F-Prime: 5’- GGAATTCGCGGCCGCTTCTAGAGATGCGCGAAATG -3’ R-Prime: 5’- GCGGGCGGCGGACTAGTCTTATTAGCCTTTTAACAC -3’ Two new bio-bricks were designed based on this part using the primers aboveSee BBa_K1789000 and BBa_K1789001 Both of those parts were sent to the registry. |
UNIQa3b39bbef62f3986-partinfo-00000003-QINU