Difference between revisions of "Part:BBa K639002"
 
(5 intermediate revisions by 3 users not shown)
Line 14: Line 14:
 
The [https://parts.igem.org/Part:BBa_K112118 BioBrick] that the Berkeley team made is in [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb format]. This means that the BioBrick is flanked by a prefix and a suffix that is different from the ones that are normally used. Therefore, this BioBrick was initially not compatible with the other BioBricks we were planning to use in our construct, as all the other BioBricks we planned to use were in BBa format.  
 
The [https://parts.igem.org/Part:BBa_K112118 BioBrick] that the Berkeley team made is in [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb format]. This means that the BioBrick is flanked by a prefix and a suffix that is different from the ones that are normally used. Therefore, this BioBrick was initially not compatible with the other BioBricks we were planning to use in our construct, as all the other BioBricks we planned to use were in BBa format.  
  
−
To deal with this problem, the rrnB P1 promoter was amplified using PCR. The original promoter made by the Berkeley iGEM team was used as template DNA. To make the amplified brick compatible with the rest of our construct, the [https://parts.igem.org/Help:BioBrick_Prefix_and_Suffix standard prefix and suffix] was added to our primers.  
+
To deal with this problem, the rrnB P1 promoter was amplified using PCR. The original promoter made by the Berkeley iGEM team was used as template DNA. To make the amplified brick compatible with the rest of our construct, the [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication OpenWetWare prefix and suffix] was added to our primers.  
  
 
[[Image:Test rrnB C3 060811 wiki.png|thumb|rrnB P1 promoter in the psb1C3 plasmid]]
 
[[Image:Test rrnB C3 060811 wiki.png|thumb|rrnB P1 promoter in the psb1C3 plasmid]]
Line 26: Line 26:
 
The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.  
 
The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.  
  
−
The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ.  
+
The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ, giving the regular pre- and suffix.
 
Plasmid from five colonies were digested with the enzymes BstBI and SpeI  
 
Plasmid from five colonies were digested with the enzymes BstBI and SpeI  
 
It seems like parallel 1 and 2 have the insert.  
 
It seems like parallel 1 and 2 have the insert.  
  
−
The part was confimerd by sequencing.
 
  
 +
'''Sequencing'''
  
 +
Sequencing confirmed the sequence of the BioBrick.
  
 +
 +
 +
'''Characterization'''
 +
 +
Characterization of our [https://parts.igem.org/Part:BBa_K639003 stress sensor] showed expression from the promoter, and plausible down-regulation from stress.
  
  

Latest revision as of 19:10, 21 September 2011

rrnB P1 promoter


Previous studies have shown that the rrnB P1 promoter is downregulated by ppGpp[1]. That is why we decided to use this promoter as the stress sensing promoter in the stress sensor. A version of rrnB P1 already existed in the Registry of Standard Biological Parts. This version was made by the Berkeley iGEM team in 2008.

PCR products from rrnB P1 BioBrick separated on 1.5 % agarose. The marked products represent rrnB P1 with regular pre/sufix

The BioBrick that the Berkeley team made is in [http://openwetware.org/wiki/Template:AndersonLab:BBb_Standard BBb format]. This means that the BioBrick is flanked by a prefix and a suffix that is different from the ones that are normally used. Therefore, this BioBrick was initially not compatible with the other BioBricks we were planning to use in our construct, as all the other BioBricks we planned to use were in BBa format.

To deal with this problem, the rrnB P1 promoter was amplified using PCR. The original promoter made by the Berkeley iGEM team was used as template DNA. To make the amplified brick compatible with the rest of our construct, the [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication OpenWetWare prefix and suffix] was added to our primers.

rrnB P1 promoter in the psb1C3 plasmid


rrnB P1.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGACGTATCCTACGCCCGTGGT

rrnB P1.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTACGCCTTCCCGCTACAGAGTCA


The PCR-product was run on a 1,5% agarose gel in order to verify that we had achieved the correct product and to separate it from any other unwanted products.

The new rrnB P1 biobrick was inserted in the psb1C3 plasmid provided by the iGem HQ, giving the regular pre- and suffix. Plasmid from five colonies were digested with the enzymes BstBI and SpeI It seems like parallel 1 and 2 have the insert.


Sequencing

Sequencing confirmed the sequence of the BioBrick.


Characterization

Characterization of our stress sensor showed expression from the promoter, and plausible down-regulation from stress.









(1) Tedin, K., A. Witte, et al. (1995). "Evaluation of the E. coli ribosomal rrnB P1 promoter and phage-derived lysis genes for the use in a biological containment system: A concept study." Journal of Biotechnology 39(2): 137-148.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]