Difference between revisions of "Part:BBa K639001"

Latest revision as of 17:12, 21 September 2011

relA (ppGpp synthase)

NOTE: This BioBrick has a PstI site in bp 1363.

relA codes for ppGpp synthase, which has been shown to be useful for regulating the rrnB P1 promoter, mimicking the stringent response when over expressed [http://www.sciencedirect.com/science/article/pii/0168165695000039 Tedin, K., A. Witte, et al. (1995)]. ppGpp should effectively down-regulate the promoter by affecting the open complex's stability and inhibiting promoter clearance.

RelA is associated with about every one in two hundred ribosomes and it becomes activated when an uncharged transfer RNA (tRNA) molecule enters the A site of the ribosome, due to the shortage of amino acid required by the tRNA.

This biobrick was made from PCR amplification using cromosomal DNA as template and primers containing [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication Openwetware prefix and suffix];

relA.fwd: GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGGTTGCGGTAAGAAGTGCACA

relA.rev: GTTTCTTCCTGCAGCGGCCGCTACTAGTACTAACTCCCGTGCAACCGACG

Sequencing

The BioBrick contains an insert; AAAGAGGAGAAATACTAGAG, immediately before the start-codon. This is probably due to primer-dimerization of some sort during PCR-cloning of the gene.

The sequence also contains four nucleotide substitutions compared to the genome of E. coli K-12. This could be due to mutations in the genome of DH5-alpha or during our cloning. All mutations were supported by two overlapping sequencing fragments. Two of the mutations are synonymous, while the other two give amino-acid changes. The mutations are shown in table 1.

Table 1: Mutations in relA BioBrick compared to K-12 sequence relA

DNA mutations	Amino acid mutations
A 323 --> G	h 108 --> r
A 456 --> G	none
G 1336 --> A	g 496 --> r
C 1440 --> T	none

Our project involved using the rrnB P1 promoter as a stress-sensor, where it would stop expressing an inhibitor for a second promoter, thus giving a signal. To show ppGpp's effect directly, we planned to express relA together with an rrnB P1 promoted lacZ. We were not able to show any effect due to cloning problems of the lacZ construct.

Sequence and Features

Assembly Compatibility:

10
INCOMPATIBLE WITH RFC[10]
Illegal PstI site found at 1383
12
INCOMPATIBLE WITH RFC[12]
Illegal PstI site found at 1383
21
COMPATIBLE WITH RFC[21]
23
INCOMPATIBLE WITH RFC[23]
Illegal PstI site found at 1383
25
INCOMPATIBLE WITH RFC[25]
Illegal PstI site found at 1383
1000
INCOMPATIBLE WITH RFC[1000]
Illegal SapI.rc site found at 1728

@@ Line 2: / Line 2: @@
 <partinfo>BBa_K639001 short</partinfo>
-NOTE: This BioBrick has a PstI site in bp 1363, and uses OWW prefix and suffix.
+'''NOTE: This BioBrick has a PstI site in bp 1363. '''
-( http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication )
-relA codes for ppGpp synthase, which has been shown to be useful for regulating the rrnB P1 promoter, mimicking the stringent response when over expressed ''[http://www.sciencedirect.com/science/article/pii/0168165695000039 Tedin, K., A. Witte, et al. (1995)]''. ppGpp should effectively down-regulate the promoter by affecting the open complex's stability and inhibiting promoter clearance.
+relA codes for ppGpp synthase, which has been shown to be useful for regulating the [https://parts.igem.org/Part:BBa_K639002 rrnB P1 promoter], mimicking the stringent response when over expressed ''[http://www.sciencedirect.com/science/article/pii/0168165695000039 Tedin, K., A. Witte, et al. (1995)]''. ppGpp should effectively down-regulate the promoter by affecting the open complex's stability and inhibiting promoter clearance.
 RelA is associated with about every one in two hundred ribosomes and it becomes activated when an uncharged transfer RNA (tRNA) molecule enters the A site of the ribosome, due to the shortage of amino acid required by the tRNA.
+This biobrick was made from PCR amplification using cromosomal DNA as template and primers containing [http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication Openwetware prefix and suffix];
+'''relA.fwd:''' GTTTCTTCGAATTCGCGGCCGCTTCTAGAGATGGTTGCGGTAAGAAGTGCACA
+'''relA.rev:''' GTTTCTTCCTGCAGCGGCCGCTACTAGTACTAACTCCCGTGCAACCGACG
+'''Sequencing'''
+The BioBrick contains an insert; AAAGAGGAGAAATACTAGAG, immediately before the start-codon. This is probably due to primer-dimerization of some sort during PCR-cloning of the gene.
+The sequence also contains four nucleotide substitutions compared to the genome of ''E. coli'' K-12. This could be due to mutations in the genome of DH5-alpha or during our cloning. All mutations were supported by two overlapping sequencing fragments. Two of the mutations are synonymous, while the other two give amino-acid changes. The mutations are shown in table 1.
+Table 1: Mutations in relA BioBrick compared to K-12 sequence relA
+{| border=1
+| align="center" |'''DNA mutations'''
+| align="center" |'''Amino acid mutations'''
+|-
+| A 323  --> G||h 108 --> r
+|-
+| A 456  --> G||none
+|-
+| G 1336 --> A||g 496 --> r
+|-
+| C 1440 --> T||none
+|-
+|}
 Our project involved using the rrnB P1 promoter as a stress-sensor, where it would stop expressing an inhibitor for a second promoter, thus giving a signal. To show ppGpp's effect directly, we planned to express relA together with an rrnB P1 promoted lacZ. We were not able to show any effect due to cloning problems of the lacZ construct.
 <!-- Add more about the biology of this part here