Difference between revisions of "Part:BBa K371000:Design"

(→‎Source)
Line 1: Line 1:
−
__NOTOC__
+
===Design Notes===
−
<partinfo>BBa_K371000 short</partinfo>
+
  
−
<partinfo>BBa_K371000 SequenceAndFeatures</partinfo>
+
In the previous literature，most of research work on pdu BMC(or pdu MCP) focus on ''Citrobacter Freundii'' and ''Salmonella enterica''. Taking all of the factors together, we choose ''Citrobacter Freundii'' as the orgin of gene pduJK. Because the whole genome of ''Citrobacter Freundii'' has not been decoded yet, we use the reference sequence sent to NCBI by Martin J.Warren group(GenBank: AM498294.1).By seraching the restriction enzyme site in  pduJK(NCBI NO.), we found a '''PstI''' site inside pduJ. And in order to make the part compile with the RFC53(A noval BioBrick assembly standard designed to facilitate protein fusion) for the following experiment. We also search the EarI, SacI ,SapI and BglII site inside pduJK. There is also a EarI site in pduK.
  
 +
We got the ''Citrobacter Freundii'' from NBRC(NBRC NO.12681). We isolate the whole genome of ''Citrobacter Freundii''. Then we use this genoe as template and mutate the PstI and PstI site by over lapping PCR. Here is a rough illustration of our mutation workflow.
 +
 +
Six primer used in mutation PCR:
 +
pduJ 1-pduJ 190
 +
 +
f1: 5'-GTTT TCTAGAG CCACAGGAGAAAAGCAGTATGAATAACG-3'
 +
     
 +
r2:5'-CGCTTGCTGC'''T'''GCGCTTCC-3'      19
 +
 +
pduJ 190-pduK 318
 +
               
 +
f3: 5'-GGAAGCGC'''A'''GCAGCAAGCG-3'      19
 +
 +
r4:5'-GGTCCTCAGGGAT'''T'''TCTTCATGTGGT-3'  26
  
−
===Design Notes===
 
−
The sequence results of pduJK, which we got by PCR from Citrobacter Freundii(NBRC NO.12681), are different from the sequence we found on the papar. We suspect that the strain we used is not same with the papar.
 
  
−
===Source===
+
pduK 318-pduK 471
 +
f5: 5'-ACCACATGAAGA'''A'''ATCCCTGAGGACC-3'  26
 +
                   
 +
r6:5'-GTTT CTGCAGCGGCCGCTACTAGTA TCACGCTTCACCTCGTTTGCC-3' 
  
−
pduJK come from Citrobacter Freundii genenom(NBRC NO.12681)
 
  
−
===References===
+
The sequence results of pduJK are different from the sequence we found on Genebank. Some silent mutation locate in the sequence with no special spacial rule. We suspect that the strain we used is not same with the papar, maybe even belong to different strain of ''Citrobacter Freundii''. However the proterin sequence alignment between the result of Martin J.Warren group, the proterin sequence of pduJK in ''Salmonella enterica'' and ours shows that the <nowiki>'mutation'</nowiki> locate in the nonconserved site. Thus we decide to continue our experement with the gene pduJK.

Revision as of 04:56, 27 October 2010

Design Notes

In the previous literature，most of research work on pdu BMC(or pdu MCP) focus on Citrobacter Freundii and Salmonella enterica. Taking all of the factors together, we choose Citrobacter Freundii as the orgin of gene pduJK. Because the whole genome of Citrobacter Freundii has not been decoded yet, we use the reference sequence sent to NCBI by Martin J.Warren group(GenBank: AM498294.1).By seraching the restriction enzyme site in pduJK(NCBI NO.), we found a PstI site inside pduJ. And in order to make the part compile with the RFC53(A noval BioBrick assembly standard designed to facilitate protein fusion) for the following experiment. We also search the EarI, SacI ,SapI and BglII site inside pduJK. There is also a EarI site in pduK.

We got the Citrobacter Freundii from NBRC(NBRC NO.12681). We isolate the whole genome of Citrobacter Freundii. Then we use this genoe as template and mutate the PstI and PstI site by over lapping PCR. Here is a rough illustration of our mutation workflow.

Six primer used in mutation PCR: pduJ 1-pduJ 190

f1: 5'-GTTT TCTAGAG CCACAGGAGAAAAGCAGTATGAATAACG-3'

r2:5'-CGCTTGCTGCTGCGCTTCC-3' 19

pduJ 190-pduK 318

f3: 5'-GGAAGCGCAGCAGCAAGCG-3' 19

r4:5'-GGTCCTCAGGGATTTCTTCATGTGGT-3' 26


pduK 318-pduK 471 f5: 5'-ACCACATGAAGAAATCCCTGAGGACC-3' 26

r6:5'-GTTT CTGCAGCGGCCGCTACTAGTA TCACGCTTCACCTCGTTTGCC-3'


The sequence results of pduJK are different from the sequence we found on Genebank. Some silent mutation locate in the sequence with no special spacial rule. We suspect that the strain we used is not same with the papar, maybe even belong to different strain of Citrobacter Freundii. However the proterin sequence alignment between the result of Martin J.Warren group, the proterin sequence of pduJK in Salmonella enterica and ours shows that the 'mutation' locate in the nonconserved site. Thus we decide to continue our experement with the gene pduJK.