Difference between revisions of "Part:BBa K411101:Design"
Blackrabbit (Talk | contribs) |
Blackrabbit (Talk | contribs) (→Design Notes) |
||
(4 intermediate revisions by 2 users not shown) | |||
Line 6: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | We used PCR to fuse the protein domains together. | |
− | + | More details of the fusion can be found on [http://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter/Materials_and_Methods#GFP_fusion_part our wiki page]. | |
− | + | ||
===Source=== | ===Source=== | ||
− | PCR fusion of GFP | + | PCR fusion of amino acids 1-158 of [[Part:BBa_E0040|GFP]], a GSSGSSGSGS peptide linker, and amino acids 1-215 of [[Part:BBa_K411100|eIF4A]]. |
+ | These four primers were used to fuse them together: | ||
+ | * GFP_split_A_FP: 5' - gaattcgcggccgcttctagag atgcgtaaaggagaagaacttttc - 3' (46bp) | ||
+ | * GFP_split_A_RP: 5' - gctgccgctgctgccgctgctgcc ttgtttgtctgccatgatgtatac - 3' (48bp) | ||
+ | * eIF4A_split_A_FP: 5' - cggcagcagcggcagcggcagc atggagccggaaggcgtcatcga - 3' (45bp) | ||
+ | * eIF4A_split_A_RP: 5' - ctgcagcggccgctactagta tca agggtctctcataaatttcttgg - 3' (47bp) | ||
===References=== | ===References=== |
Latest revision as of 17:16, 26 October 2010
GFP_split_A + Linker + eIF4A_split_A
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 741
Illegal BglII site found at 1037 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1139
Design Notes
We used PCR to fuse the protein domains together. More details of the fusion can be found on [http://2010.igem.org/Team:NYMU-Taipei/Project/Speedy_reporter/Materials_and_Methods#GFP_fusion_part our wiki page].
Source
PCR fusion of amino acids 1-158 of GFP, a GSSGSSGSGS peptide linker, and amino acids 1-215 of eIF4A. These four primers were used to fuse them together:
- GFP_split_A_FP: 5' - gaattcgcggccgcttctagag atgcgtaaaggagaagaacttttc - 3' (46bp)
- GFP_split_A_RP: 5' - gctgccgctgctgccgctgctgcc ttgtttgtctgccatgatgtatac - 3' (48bp)
- eIF4A_split_A_FP: 5' - cggcagcagcggcagcggcagc atggagccggaaggcgtcatcga - 3' (45bp)
- eIF4A_split_A_RP: 5' - ctgcagcggccgctactagta tca agggtctctcataaatttcttgg - 3' (47bp)