Difference between revisions of "Part:BBa K346000:Design"
 
(2 intermediate revisions by one other user not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K346000 short</partinfo>
 
<partinfo>BBa_K346000 short</partinfo>
−
T3 polymerase can drive expression of different T3 promoters in T3 phage. Since during different time the phage need different expression level of regulatory genes, there should be T3 promoters of different level. Therefore we designed to use T3 polymerase and T3 promoter to regulate the expression level of downstream gene.
+
 
−
In our experiment, we constructed 14 different promoters by primer annealing and with standard digestion to put it into standard plasmid.Then we put GFP under T3 promoter's regulation to function as a reporter. By transforming another plasmid containing T7 promoter+rbs+T3 polymerase, we were able to calculate and compare the expression level of different promoters.
+
<html><a href="https://static.igem.org/mediawiki/parts/1/14/Design1.jpg" target="blank"><img src="https://static.igem.org/mediawiki/parts/1/14/Design1.jpg"></a></html>
−
The result shows that under IPTG induction, different promoters really have different expression kinetics. We put them in order of their expression level and find that phi9 T3 promoter has a medium expression level, and its expression is more robust.  
+
 
 +
T3 RNA polymerase has a dramatically high transcription rating; therefore a strong RBS is not necessary as a medium RBS (BBa_B0032) will be enough to reach the maximum of transcription activation at T3 promoters.  
 +
 
 +
What’s more, we observed that maximum transcription rating might result in protein misfolding sometimes and the apparent transcription activation fold will decrease instead. Therefore we strongly recommend a low expression intensity of T3 polymerase in the case of genetic circuit design, or the combination of T3 polymerase with a low-strength T3 promoter, such as promoter phi 1.3 or 4.3. You can find more info about the T3 promoter intensity in the following Figure
 +
 
 +
<html><a href="https://static.igem.org/mediawiki/parts/a/ae/T3POLfig4.png" target="blank"><img src="https://static.igem.org/mediawiki/parts/a/ae/T3POLfig4.png"></a></html>
 +
 
 +
'''Figure 5: The strength of different T3 promoters under the same expression level of T3 polymerase. BBa_E0840 was combined with 11 T3 promoters from the genome of T3 phage. The x axis denotes strains that only differ in the T3 promoter strength, in accordance with the order from strong to weak. The Y axis denotes the GFP intensity normalized by OD600. We can see that these T3 promoters can be divided into 3 subgroups: weak, medium and strong. (You can find more details about the promoter intensity characterization on the Experience Page)'''
 +
 
  
 
<partinfo>BBa_K346000 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K346000 SequenceAndFeatures</partinfo>
Line 11: Line 19:
 
===Source===
 
===Source===
  
−
T3 phage
+
Enterobacteria phage T3 (Bacteriophage T3).
 +
----
 +
We used the following primers to standardize this part:
 +
T3pol_For: ccg gaattc gcggccgc t tctag ATGAACATCATCGAAAACATCGAA
 +
T3pol_Rev: aaa ctgcag cggccgc t actagt a TTATGCAAAGGCAAAGTCAGAC
  
 
===References===
 
===References===

Latest revision as of 07:11, 25 October 2010

RBS(B0032)+T3 DNA-directed RNA polymerase

T3 RNA polymerase has a dramatically high transcription rating; therefore a strong RBS is not necessary as a medium RBS (BBa_B0032) will be enough to reach the maximum of transcription activation at T3 promoters.

What’s more, we observed that maximum transcription rating might result in protein misfolding sometimes and the apparent transcription activation fold will decrease instead. Therefore we strongly recommend a low expression intensity of T3 polymerase in the case of genetic circuit design, or the combination of T3 polymerase with a low-strength T3 promoter, such as promoter phi 1.3 or 4.3. You can find more info about the T3 promoter intensity in the following Figure

Figure 5: The strength of different T3 promoters under the same expression level of T3 polymerase. BBa_E0840 was combined with 11 T3 promoters from the genome of T3 phage. The x axis denotes strains that only differ in the T3 promoter strength, in accordance with the order from strong to weak. The Y axis denotes the GFP intensity normalized by OD600. We can see that these T3 promoters can be divided into 3 subgroups: weak, medium and strong. (You can find more details about the promoter intensity characterization on the Experience Page)



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 2585


Source

Enterobacteria phage T3 (Bacteriophage T3).

We used the following primers to standardize this part: T3pol_For: ccg gaattc gcggccgc t tctag ATGAACATCATCGAAAACATCGAA T3pol_Rev: aaa ctgcag cggccgc t actagt a TTATGCAAAGGCAAAGTCAGAC

References