Difference between revisions of "Part:BBa K330000:Design"

(→‎Design Notes)
(→‎Design Notes)
 
(One intermediate revision by the same user not shown)
Line 9: Line 9:
 
In order to prepare a ready-to-use FLAG-tag which can be easily added to other BioBrick™ Standard Biological Parts (for separation, recognition, etc.), a FLAG-tag encoding sequence flanked by standard BioBrick™ prefix (EcoRI, XbaI) and suffix (SpeI, PstI) is designed and ligated into standard DNA-shipping plasmid backbone pSB1C3. The DNA sequence of the FLAG-tag is as follows: 5’ gactacaaggatgacgacgacaag 3’; while the corresponding peptide sequence would be as follow: N-DYKDDDDK-C.
 
In order to prepare a ready-to-use FLAG-tag which can be easily added to other BioBrick™ Standard Biological Parts (for separation, recognition, etc.), a FLAG-tag encoding sequence flanked by standard BioBrick™ prefix (EcoRI, XbaI) and suffix (SpeI, PstI) is designed and ligated into standard DNA-shipping plasmid backbone pSB1C3. The DNA sequence of the FLAG-tag is as follows: 5’ gactacaaggatgacgacgacaag 3’; while the corresponding peptide sequence would be as follow: N-DYKDDDDK-C.
  
−
FLAG-tag is a polypeptide protein tag commonly used in molecular biology, particularly recombinant DNA technology. It can be tagged to the N-terminal or C-terminal of a protein coding sequence; it can also be added between two domains of a chimeric protein, giving that that the insertion of FLAG-tag will not affect the expected function of the polypeptide (one of iGEM10_HKUST project constructs: signal peptide - flagtag - DD13-RNAIII inhibiting peptide. See details at http://2010.igem.org/Team:HKUST/Project/Experiment_Design#5). FLAG-tag is used in affinity chromatography to separate or detect recombinant, overexpressed protein from wild-type protein; it can also be used in cellular localization studies by immunofluorescence or detection by SDS-PAGE protein electrophoresis.
+
FLAG-tag is a polypeptide protein tag commonly used in molecular biology, particularly recombinant DNA technology. It can be tagged to the N-terminal or C-terminal of a protein coding sequence; it can also be added between two domains of a chimeric protein, giving that the insertion of FLAG-tag will not affect the expected function of the polypeptide (e.g. one of iGEM10_HKUST constructs: signal peptide - flagtag - DD13 - RNAIII inhibiting peptide, see details at http://2010.igem.org/Team:HKUST/Project/Experiment_Design#5). FLAG-tag is used in affinity chromatography to separate or detect recombinant, over-expressed protein from wild-type protein; it can also be used in cellular localization studies by immunofluorescence or detection by SDS-PAGE protein electrophoresis.
  
 
===Source===
 
===Source===

Latest revision as of 07:58, 23 October 2010

Protein Tag: FLAG-tag


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

In order to prepare a ready-to-use FLAG-tag which can be easily added to other BioBrick™ Standard Biological Parts (for separation, recognition, etc.), a FLAG-tag encoding sequence flanked by standard BioBrick™ prefix (EcoRI, XbaI) and suffix (SpeI, PstI) is designed and ligated into standard DNA-shipping plasmid backbone pSB1C3. The DNA sequence of the FLAG-tag is as follows: 5’ gactacaaggatgacgacgacaag 3’; while the corresponding peptide sequence would be as follow: N-DYKDDDDK-C.

FLAG-tag is a polypeptide protein tag commonly used in molecular biology, particularly recombinant DNA technology. It can be tagged to the N-terminal or C-terminal of a protein coding sequence; it can also be added between two domains of a chimeric protein, giving that the insertion of FLAG-tag will not affect the expected function of the polypeptide (e.g. one of iGEM10_HKUST constructs: signal peptide - flagtag - DD13 - RNAIII inhibiting peptide, see details at http://2010.igem.org/Team:HKUST/Project/Experiment_Design#5). FLAG-tag is used in affinity chromatography to separate or detect recombinant, over-expressed protein from wild-type protein; it can also be used in cellular localization studies by immunofluorescence or detection by SDS-PAGE protein electrophoresis.

Source

aaaaaa

References