Difference between revisions of "Part:BBa K5267010"
(19 intermediate revisions by 2 users not shown) | |||
Line 3: | Line 3: | ||
<partinfo>BBa_K5267010 short</partinfo> | <partinfo>BBa_K5267010 short</partinfo> | ||
− | + | Transpose and respond to calcium ion signals | |
− | + | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
Line 17: | Line 16: | ||
<partinfo>BBa_K5267010 parameters</partinfo> | <partinfo>BBa_K5267010 parameters</partinfo> | ||
<!-- --> | <!-- --> | ||
+ | |||
+ | ===Profile=== | ||
+ | Name: Pmin_7*NFAT promoter | ||
+ | <br>Base Pairs: 249bp | ||
+ | <br>Origin: Homo sapiens | ||
+ | <br>Properties: Transpose and respond to calcium ion signals | ||
+ | |||
+ | |||
+ | ===Usage and Biology=== | ||
+ | <p>Nuclear factor of activated T cells (NFAT) was first identified over two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFATs are a family of Ca²⁺ dependent transcription factors that play a central role in the morphogenesis, development, and physiological activities of various cell types and organ systems. </p> | ||
+ | <p>NFAT is widely expressed across different animal tissues and cell types, serving as a key regulatory point in multiple intracellular signal transduction pathways. It plays crucial roles in the immune system, nervous system development, axon growth, and various nervous system diseases. In this project, NFAT is utilized to monitor the effects of increases in intracellular Ca²⁺ concentrations indirectly [1].</p> | ||
+ | |||
+ | ===Special design=== | ||
+ | To non-invasively assess the impact of elevated intracellular calcium ion (Ca²⁺) concentrations, we developed a series of Ca²⁺ inducible NanoLuc reporters based on the Ca²⁺ dependent activation of dimeric NFAT, as illustrated in Figure 1[2]. These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL-4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′) with minimal CMV promoter ([https://parts.igem.org/Part:BBa_K5267049 Part:BBa K5267049]). This setup is anticipated to drive the transcription of the NanoLuc reporter gene when NFAT is dephosphorylated due to the significantly increased intracellular Ca²⁺ concentrations (Figure 1). | ||
+ | |||
+ | |||
+ | <html> | ||
+ | |||
+ | <figure class="figure"> | ||
+ | <div style="width=100%;height=auto;align-items:center"> | ||
+ | <img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/008.png" class="figure-img img-fluid rounded" height="200px"> | ||
+ | |||
+ | </figure> | ||
+ | |||
+ | </html> | ||
+ | <br>'''Figure 1. Schematic representation showing the construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.''' | ||
+ | |||
+ | ==Function test== | ||
+ | To elucidate the effects of intracellular Ca²⁺ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed synthetic NFAT promoters such as Pmin_7*NFAT promoter ([https://parts.igem.org/Part:BBa_K5267010 Part:BBa K5267010]). This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca²⁺ concentrations [3]. | ||
+ | <br>Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca²⁺) concentration by inhibiting the calcium ATPasein the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway. | ||
+ | <br>Theoretically, Thapsigargin-treated cell would have an upregulated intracellular Ca²⁺, which activate NFAT pathways and induce the transcription of synthetic NFAT promoter, we thereby can analyze the sensitivity and activation threshold of the NFAT pathway based on the Pmin_7*NFAT promoter and Thapsigargin. | ||
+ | |||
+ | |||
+ | ===Method=== | ||
+ | We introduced the expression vectors encoding the novel synthetic NFAT promoter ([https://parts.igem.org/Part:BBa_K5267007 Part:BBa K5267007]) into HEK293T cells via co-transfection, followed by the addition of thapsigargin to trigger an intracellular calcium ion (Ca²⁺) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group. After 48-hour exposure to thapsigargin, the activity of NanoLuc (measured as relative light units, RLU) was quantified to assess the intracellular Ca²⁺ response. | ||
+ | |||
+ | |||
+ | ===Result=== | ||
+ | <html> | ||
+ | |||
+ | <figure class="figure"> | ||
+ | <div style="width=100%;height=auto;align-items:center"> | ||
+ | <img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/019.png" class="figure-img img-fluid rounded" height="400px"> | ||
+ | |||
+ | </figure> | ||
+ | |||
+ | </html> | ||
+ | '''Figure 2. Synthetic NFAT promoter (PNFAT) in response to thapsigargin-induced intracellular calcium ion signaling elevation.''' | ||
+ | |||
+ | <br>HEK293T cells were transfected with plasmids containing different synthetic promoters with 1×/5×/6×/7× NFAT elements, respectively. The NanoLuc expression levels were measured 48 hours after thapsigargin stimulation (n = 3 independent experiments). The results showed that the stimulation of the synthetic NFAT promoter Pmin_7×NFAT ([https://parts.igem.org/Part:BBa_K5267010 Part:BBa K5267010]) with 10 nM thapsigargin resulted in a significant increase in the expression of the NanoLuc reporter gene, with the thapsigargin-treated group exhibiting a 21.33-fold higher expression compared to the control group. This demonstrated that the synthetic NFAT promoter Pmin_7×NFAT can sense and characterize intracellular calcium ion concentration as expected. | ||
+ | <br>Nluc expression increase with time could be detected in cells transfected with pNC103(PNFAT_7-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT (Figure. 3). | ||
+ | <html> | ||
+ | |||
+ | <figure class="figure"> | ||
+ | <div style="width=100%;height=auto;align-items:center"> | ||
+ | <img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/024.jpg" class="figure-img img-fluid rounded" height="400px"> | ||
+ | |||
+ | </figure> | ||
+ | |||
+ | </html> | ||
+ | <br>'''Figure 3. Step-response dynamics of translated cells under thapsigargin treatment. HEK293T cells were transfected with pNC103(PNFAT_7-IgK-Nluc).''' | ||
+ | <br>Cells were treated with either DMSO or thapsigargin 6 hours post transcription. Data represents mean±SD of nanoluc expression levels measured at 24 h after melatonin stimulation (n = 3 independent experiments). | ||
+ | ===Sequence=== | ||
+ | Top: | ||
+ | <br>agctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttta | ||
+ | <br>tacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattg | ||
+ | <br>gaaaattttatacacgttctagctacattggaaaattttatacacgttagactttagagggtatataatggaagctcgac | ||
+ | <br>ttccagctt | ||
+ | |||
+ | |||
+ | ===Reference=== | ||
+ | [1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818. | ||
+ | <br>[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605. | ||
+ | <br>[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189. |
Latest revision as of 13:59, 2 October 2024
Pmin_7*NFAT promoter
Transpose and respond to calcium ion signals Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Profile
Name: Pmin_7*NFAT promoter
Base Pairs: 249bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals
Usage and Biology
Nuclear factor of activated T cells (NFAT) was first identified over two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFATs are a family of Ca²⁺ dependent transcription factors that play a central role in the morphogenesis, development, and physiological activities of various cell types and organ systems.
NFAT is widely expressed across different animal tissues and cell types, serving as a key regulatory point in multiple intracellular signal transduction pathways. It plays crucial roles in the immune system, nervous system development, axon growth, and various nervous system diseases. In this project, NFAT is utilized to monitor the effects of increases in intracellular Ca²⁺ concentrations indirectly [1].
Special design
To non-invasively assess the impact of elevated intracellular calcium ion (Ca²⁺) concentrations, we developed a series of Ca²⁺ inducible NanoLuc reporters based on the Ca²⁺ dependent activation of dimeric NFAT, as illustrated in Figure 1[2]. These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL-4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′) with minimal CMV promoter (Part:BBa K5267049). This setup is anticipated to drive the transcription of the NanoLuc reporter gene when NFAT is dephosphorylated due to the significantly increased intracellular Ca²⁺ concentrations (Figure 1).