Difference between revisions of "Part:BBa K5267009"

(→‎Function test)
 
(12 intermediate revisions by 2 users not shown)
Line 25: Line 25:
  
 
===Usage and Biology===
 
===Usage and Biology===
−
Nuclear factor of activated T cells (NFAT) was first identified more than two
+
<p>Nuclear factor of activated T cells (NFAT) was first identified over two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFATs are a family of Ca²⁺ dependent transcription factors that play a central role in the morphogenesis, development, and physiological activities of various cell types and organ systems. </p>
−
decades ago as a major stimulation-responsive DNA-binding factor and transcriptional
+
<p>NFAT is widely expressed across different animal tissues and cell types, serving as a key regulatory point in multiple intracellular signal transduction pathways. It plays crucial roles in the immune system, nervous system development, axon growth, and various nervous system diseases. In this project, NFAT is utilized to monitor the effects of increases in intracellular Ca²⁺ concentrations indirectly [1].</p>
−
regulator in T cells. NFAT is a family of transcription factors. It was originally discovered in activated T cells as a transcription factor capable of binding to the promoter of human interleukin-2 (IL2) to rapidly induce its expression. Widely expressed in a variety of animal tissues and cells, NFAT is a key regulatory point of multiple intracellular signal transduction pathways, and also plays an important role in immune system, nervous system development, axon growth, and nervous system diseases，in this project it used to indirectly monitor effects of increases in the intracellular Ca2+ concentrations.[1]
+
−
 
+
  
 
===Special design===
 
===Special design===
−
In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].  
+
To non-invasively assess the impact of elevated intracellular calcium ion (Ca²⁺) concentrations, we developed a series of Ca²⁺ inducible NanoLuc reporters based on the Ca²⁺ dependent activation of dimeric NFAT, as illustrated in Figure 1[2]. These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL-4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′) with minimal CMV promoter ([https://parts.igem.org/Part:BBa_K5267049 Part:BBa K5267049]). This setup is anticipated to drive the transcription of the NanoLuc reporter gene when NFAT is dephosphorylated due to the significantly increased intracellular Ca²⁺ concentrations (Figure 1).
−
<br>These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. '''(Figure 1)'''
+
 
−
<br>To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]
+
 
 
<html>
 
<html>
  
 
<figure class="figure">
 
<figure class="figure">
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
−
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/7.jpg" class="figure-img img-fluid rounded"  height="200px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/008.png" class="figure-img img-fluid rounded"  height="200px">
  
 
</figure>
 
</figure>
  
 
</html>
 
</html>
−
<br>Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.
+
<br>'''Figure 1. Schematic representation showing the construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.'''
−
 
+
  
 
==Function test==
 
==Function test==
−
Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca +) concentration by inhibiting the calcium atpase (SERCA pump) in the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway, thereby analyzing the sensitivity and activation threshold of the NFAT pathway.
+
To elucidate the effects of intracellular Ca²⁺ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed synthetic NFAT promoters such as Pmin_6*NFAT promoter ([https://parts.igem.org/Part:BBa_K5267009 Part:BBa K5267009]). This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca²⁺ concentrations [3].
 +
<br>Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca²⁺) concentration by inhibiting the calcium ATPasein the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway.
 +
<br>Theoretically, Thapsigargin-treated cell would have an upregulated intracellular Ca²⁺, which activate NFAT pathways and induce the transcription of synthetic NFAT promoter, we thereby can analyze the sensitivity and activation threshold of the NFAT pathway based on the Pmin_6*NFAT promoter and Thapsigargin.
 +
 
  
 
===Method===
 
===Method===
−
We introduced the expression vectors encoding the novel NanoLuc-reporter constructs into HEK293T cells via co-transfection, followed by the application of thapsigargin to elicit an intracellular calcium ion (Ca2+) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group (BBa_K5267049). Subsequent to a 48-hour exposure to thapsigargin, the luminescence intensity of the reporter element NanoLuc (measured as relative light units, RLU) was quantified across all experimental cohorts to assess the transcriptional activity induced by the treatment.
+
We introduced the expression vectors encoding the novel synthetic NFAT promoter ([https://parts.igem.org/Part:BBa_K5267007 Part:BBa K5267007]) into HEK293T cells via co-transfection, followed by the addition of thapsigargin to trigger an intracellular calcium ion (Ca²⁺) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group. After 48-hour exposure to thapsigargin, the activity of NanoLuc (measured as relative light units, RLU) was quantified to assess the intracellular Ca²⁺ response.
 +
 
  
 
===Result===
 
===Result===
Line 57: Line 58:
 
<figure class="figure">
 
<figure class="figure">
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
−
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/111213.png" class="figure-img img-fluid rounded"  height="400px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/019.png" class="figure-img img-fluid rounded"  height="400px">
  
 
</figure>
 
</figure>
  
 
</html>
 
</html>
−
'''Figure 2.''' NFAT activation in response to calcium ion signaling.  
+
'''Figure 2. Synthetic NFAT promoter (PNFAT) in response to thapsigargin-induced intracellular calcium ion signaling elevation.'''
−
<br>HEK-293T cells were transfected with plasmids containing different promoters with 1×/5×/6×/7×NFAT elements respectively.  Data are mean±SD of NanoLuc expression levels measured at 48 h after thapsigargin stimulation (n = 3 independent experiments).Upon a 48-hour incubation period, stimulation of the NFAT promoter with 10 nM thapsigargin resulted in a mean augmentation of the NanoLuc reporter gene expression to a magnitude that was 1.96-fold superior to that ascertained in the absence of thapsigargin induction.
+
  
 +
<br>HEK293T cells were transfected with plasmids containing different synthetic promoters with 1×/5×/6×/7× NFAT elements, respectively. The NanoLuc expression levels were measured 48 hours after thapsigargin stimulation (n = 3 independent experiments). The results showed that the stimulation of the synthetic NFAT promoter Pmin_6×NFAT ([https://parts.igem.org/Part:BBa_K5267009 Part:BBa K5267009]) with 10 nM thapsigargin resulted in a significant increase in the expression of the NanoLuc reporter gene, with the thapsigargin-treated group exhibiting a 15.5-fold higher expression compared to the control group. This demonstrated that the synthetic NFAT promoter Pmin_6×NFAT can sense and characterize intracellular calcium ion concentration as expected.
 +
<br>Nluc expression increase with time could be detected in cells transfected with pNC104(PNFAT_6-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT  (Figure. 3).
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/023.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
 +
 +
</html>
 +
<br>'''Figure 3. Step-response dynamics of  translated cells under thapsigargin treatment. HEK293T cells were transfected with pNC104(PNFAT_6-IgK-Nluc).'''
 +
<br>Cells were treated with either DMSO or thapsigargin 6 hours post transcription. Data represents mean±SD of nanoluc expression levels measured at 24 h after melatonin stimulation (n = 3 independent experiments).
 
===Sequence===
 
===Sequence===
 
Top:  
 
Top:  

Latest revision as of 13:57, 2 October 2024


Pmin_6*NFAT promoter

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: Pmin_6*NFAT promoter
Base Pairs: 219bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals


Usage and Biology

Nuclear factor of activated T cells (NFAT) was first identified over two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFATs are a family of Ca²⁺ dependent transcription factors that play a central role in the morphogenesis, development, and physiological activities of various cell types and organ systems.

NFAT is widely expressed across different animal tissues and cell types, serving as a key regulatory point in multiple intracellular signal transduction pathways. It plays crucial roles in the immune system, nervous system development, axon growth, and various nervous system diseases. In this project, NFAT is utilized to monitor the effects of increases in intracellular Ca²⁺ concentrations indirectly [1].

Special design

To non-invasively assess the impact of elevated intracellular calcium ion (Ca²⁺) concentrations, we developed a series of Ca²⁺ inducible NanoLuc reporters based on the Ca²⁺ dependent activation of dimeric NFAT, as illustrated in Figure 1[2]. These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL-4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′) with minimal CMV promoter (Part:BBa K5267049). This setup is anticipated to drive the transcription of the NanoLuc reporter gene when NFAT is dephosphorylated due to the significantly increased intracellular Ca²⁺ concentrations (Figure 1).



Figure 1. Schematic representation showing the construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.

Function test

To elucidate the effects of intracellular Ca²⁺ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed synthetic NFAT promoters such as Pmin_6*NFAT promoter (Part:BBa K5267009). This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca²⁺ concentrations [3].
Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca²⁺) concentration by inhibiting the calcium ATPasein the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway.
Theoretically, Thapsigargin-treated cell would have an upregulated intracellular Ca²⁺, which activate NFAT pathways and induce the transcription of synthetic NFAT promoter, we thereby can analyze the sensitivity and activation threshold of the NFAT pathway based on the Pmin_6*NFAT promoter and Thapsigargin.


Method

We introduced the expression vectors encoding the novel synthetic NFAT promoter (Part:BBa K5267007) into HEK293T cells via co-transfection, followed by the addition of thapsigargin to trigger an intracellular calcium ion (Ca²⁺) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group. After 48-hour exposure to thapsigargin, the activity of NanoLuc (measured as relative light units, RLU) was quantified to assess the intracellular Ca²⁺ response.


Result

Figure 2. Synthetic NFAT promoter (PNFAT) in response to thapsigargin-induced intracellular calcium ion signaling elevation.


HEK293T cells were transfected with plasmids containing different synthetic promoters with 1×/5×/6×/7× NFAT elements, respectively. The NanoLuc expression levels were measured 48 hours after thapsigargin stimulation (n = 3 independent experiments). The results showed that the stimulation of the synthetic NFAT promoter Pmin_6×NFAT (Part:BBa K5267009) with 10 nM thapsigargin resulted in a significant increase in the expression of the NanoLuc reporter gene, with the thapsigargin-treated group exhibiting a 15.5-fold higher expression compared to the control group. This demonstrated that the synthetic NFAT promoter Pmin_6×NFAT can sense and characterize intracellular calcium ion concentration as expected.
Nluc expression increase with time could be detected in cells transfected with pNC104(PNFAT_6-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT (Figure. 3).


Figure 3. Step-response dynamics of translated cells under thapsigargin treatment. HEK293T cells were transfected with pNC104(PNFAT_6-IgK-Nluc).
Cells were treated with either DMSO or thapsigargin 6 hours post transcription. Data represents mean±SD of nanoluc expression levels measured at 24 h after melatonin stimulation (n = 3 independent experiments).

Sequence

Top:
agctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttta
tacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattg
gaaaattttatacacgttagactttagagggtatataatggaagctcgacttccagctt


Reference

[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.