Difference between revisions of "Part:BBa K5267009"

 
(20 intermediate revisions by 2 users not shown)
Line 18: Line 18:
  
 
===Profile===
 
===Profile===
Name: P_min5*NFAT_IL4
+
Name: Pmin_6*NFAT promoter
<br>Base Pairs: 191bp
+
<br>Base Pairs: 219bp
 
<br>Origin: Homo sapiens  
 
<br>Origin: Homo sapiens  
 
<br>Properties: Transpose and respond to calcium ion signals
 
<br>Properties: Transpose and respond to calcium ion signals
Line 25: Line 25:
  
 
===Usage and Biology===
 
===Usage and Biology===
P_min is short for minimal promoter, which is the minimal version of the promoter sequence that contains elements necessary for transcription factor binding, but usually does not contain enhancers or other regulatory elements<sup>[1]</sup>.
+
<p>Nuclear factor of activated T cells (NFAT) was first identified over two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFATs are a family of Ca²⁺ dependent transcription factors that play a central role in the morphogenesis, development, and physiological activities of various cell types and organ systems. </p>
<br>NFAT_IL4 is a component of interleukin-4 (IL-4) transcription promoter which is responsive to nuclear factor of activated T cells (NFAT). And NFAT can response to calcium ions. In our project, we choose calcium pathway as one of the downstream pathways of melatonin receptor MT1. So NFAT_IL4 can characterize the binding of melatonin and MT1.
+
<p>NFAT is widely expressed across different animal tissues and cell types, serving as a key regulatory point in multiple intracellular signal transduction pathways. It plays crucial roles in the immune system, nervous system development, axon growth, and various nervous system diseases. In this project, NFAT is utilized to monitor the effects of increases in intracellular Ca²⁺ concentrations indirectly [1].</p>
 
+
  
 
===Special design===
 
===Special design===
5*NFAT_IL4 is the 5-fold version of NFAT_IL4. Considering that the expression effect of a single responder is weak, we insert multiple tandem repeats of the same responder element to the upstream of P_min to enhance the activation of the signaling pathway. This part is the combination of NFAT_IL4 clone four times and P_min.
+
To non-invasively assess the impact of elevated intracellular calcium ion (Ca²⁺) concentrations, we developed a series of Ca²⁺ inducible NanoLuc reporters based on the Ca²⁺ dependent activation of dimeric NFAT, as illustrated in Figure 1[2]. These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL-4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′) with minimal CMV promoter ([https://parts.igem.org/Part:BBa_K5267049 Part:BBa K5267049]). This setup is anticipated to drive the transcription of the NanoLuc reporter gene when NFAT is dephosphorylated due to the significantly increased intracellular Ca²⁺ concentrations (Figure 1).
  
  
===Function test===
 
In order to test the function of calcium ion response element, P_min5*NFAT_IL4 is loaded onto a vector which is equipped with sleeping beauty transposon site and nano luciferase (Nluc) reporter gene downstream. Once the fluorescent signal of Nluc expression be detected, this marks the successful binding of calcium ions and P_min5*NFAT_IL4. '''(Figure 1)'''
 
In Figure 1, we can find that the expression level of Nluc gene in cells supplemented with P_min5*NFAT_IL4 is significantly increased compared with the blank control, which proves that the calcium pathway responded successfully.
 
 
<html>
 
<html>
  
 
<figure class="figure">
 
<figure class="figure">
 
<div style="width=100%;height=auto;align-items:center">
 
<div style="width=100%;height=auto;align-items:center">
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/3.jpg" class="figure-img img-fluid rounded"  height="400px">
+
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/008.png" class="figure-img img-fluid rounded"  height="200px">
 +
 
 +
</figure>
  
 
</html>
 
</html>
 +
<br>'''Figure 1. Schematic representation showing the construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.'''
  
 +
==Function test==
 +
To elucidate the effects of intracellular Ca²⁺ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed synthetic NFAT promoters such as Pmin_6*NFAT promoter ([https://parts.igem.org/Part:BBa_K5267009 Part:BBa K5267009]). This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca²⁺ concentrations [3].
 +
<br>Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca²⁺) concentration by inhibiting the calcium ATPasein the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway.
 +
<br>Theoretically, Thapsigargin-treated cell would have an upregulated intracellular Ca²⁺, which activate NFAT pathways and induce the transcription of synthetic NFAT promoter, we thereby can analyze the sensitivity and activation threshold of the NFAT pathway based on the Pmin_6*NFAT promoter and Thapsigargin.
  
 +
 +
===Method===
 +
We introduced the expression vectors encoding the novel synthetic NFAT promoter ([https://parts.igem.org/Part:BBa_K5267007 Part:BBa K5267007]) into HEK293T cells via co-transfection, followed by the addition of thapsigargin to trigger an intracellular calcium ion (Ca²⁺) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group. After 48-hour exposure to thapsigargin, the activity of NanoLuc (measured as relative light units, RLU) was quantified to assess the intracellular Ca²⁺ response.
 +
 +
 +
===Result===
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/019.png" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
 +
 +
</html>
 +
'''Figure 2. Synthetic NFAT promoter (PNFAT) in response to thapsigargin-induced intracellular calcium ion signaling elevation.'''
 +
 +
<br>HEK293T cells were transfected with plasmids containing different synthetic promoters with 1×/5×/6×/7× NFAT elements, respectively. The NanoLuc expression levels were measured 48 hours after thapsigargin stimulation (n = 3 independent experiments). The results showed that the stimulation of the synthetic NFAT promoter Pmin_6×NFAT ([https://parts.igem.org/Part:BBa_K5267009 Part:BBa K5267009]) with 10 nM thapsigargin resulted in a significant increase in the expression of the NanoLuc reporter gene, with the thapsigargin-treated group exhibiting a 15.5-fold higher expression compared to the control group. This demonstrated that the synthetic NFAT promoter Pmin_6×NFAT can sense and characterize intracellular calcium ion concentration as expected.
 +
<br>Nluc expression increase with time could be detected in cells transfected with pNC104(PNFAT_6-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT  (Figure. 3).
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/023.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
 +
 +
</html>
 +
<br>'''Figure 3. Step-response dynamics of  translated cells under thapsigargin treatment. HEK293T cells were transfected with pNC104(PNFAT_6-IgK-Nluc).'''
 +
<br>Cells were treated with either DMSO or thapsigargin 6 hours post transcription. Data represents mean±SD of nanoluc expression levels measured at 24 h after melatonin stimulation (n = 3 independent experiments).
 
===Sequence===
 
===Sequence===
 
Top:  
 
Top:  
<br>GGAGTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTCTA
+
<br>agctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttta
<br>GCTACATTGGAAAATTTTATACACGTTCTAGCTACATTGGAAAATTTTATACACGTTAGACTCTAGAGGGTATATAATGGAAGCTCGACTTC
+
<br>tacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattg
<br>CAGTACT
+
<br>gaaaattttatacacgttagactttagagggtatataatggaagctcgacttccagctt
  
  
 
===Reference===
 
===Reference===
[1] Hawley DK, McClure WR. Compilation and analysis of Escherichia coli promoter DNA sequences. Nucleic Acids Res. 1983 Apr 25.
+
[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
<br>[2] Rao, A., Luo, C., & Hogan, P.G. (1997). Transcription factors of the NFAT family: regulation and function. Annu. Rev. Immunol. 1997.
+
<br>[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
<br>[3] Rooney JW, Hodge MR, McCaffrey PG, Rao A, Glimcher LH. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 1994 Feb 1.
+
<br>[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.

Latest revision as of 13:57, 2 October 2024


Pmin_6*NFAT promoter

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: Pmin_6*NFAT promoter
Base Pairs: 219bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals


Usage and Biology

Nuclear factor of activated T cells (NFAT) was first identified over two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFATs are a family of Ca²⁺ dependent transcription factors that play a central role in the morphogenesis, development, and physiological activities of various cell types and organ systems.

NFAT is widely expressed across different animal tissues and cell types, serving as a key regulatory point in multiple intracellular signal transduction pathways. It plays crucial roles in the immune system, nervous system development, axon growth, and various nervous system diseases. In this project, NFAT is utilized to monitor the effects of increases in intracellular Ca²⁺ concentrations indirectly [1].

Special design

To non-invasively assess the impact of elevated intracellular calcium ion (Ca²⁺) concentrations, we developed a series of Ca²⁺ inducible NanoLuc reporters based on the Ca²⁺ dependent activation of dimeric NFAT, as illustrated in Figure 1[2]. These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL-4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′) with minimal CMV promoter (Part:BBa K5267049). This setup is anticipated to drive the transcription of the NanoLuc reporter gene when NFAT is dephosphorylated due to the significantly increased intracellular Ca²⁺ concentrations (Figure 1).



Figure 1. Schematic representation showing the construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.

Function test

To elucidate the effects of intracellular Ca²⁺ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed synthetic NFAT promoters such as Pmin_6*NFAT promoter (Part:BBa K5267009). This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca²⁺ concentrations [3].
Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca²⁺) concentration by inhibiting the calcium ATPasein the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway.
Theoretically, Thapsigargin-treated cell would have an upregulated intracellular Ca²⁺, which activate NFAT pathways and induce the transcription of synthetic NFAT promoter, we thereby can analyze the sensitivity and activation threshold of the NFAT pathway based on the Pmin_6*NFAT promoter and Thapsigargin.


Method

We introduced the expression vectors encoding the novel synthetic NFAT promoter (Part:BBa K5267007) into HEK293T cells via co-transfection, followed by the addition of thapsigargin to trigger an intracellular calcium ion (Ca²⁺) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group. After 48-hour exposure to thapsigargin, the activity of NanoLuc (measured as relative light units, RLU) was quantified to assess the intracellular Ca²⁺ response.


Result

Figure 2. Synthetic NFAT promoter (PNFAT) in response to thapsigargin-induced intracellular calcium ion signaling elevation.


HEK293T cells were transfected with plasmids containing different synthetic promoters with 1×/5×/6×/7× NFAT elements, respectively. The NanoLuc expression levels were measured 48 hours after thapsigargin stimulation (n = 3 independent experiments). The results showed that the stimulation of the synthetic NFAT promoter Pmin_6×NFAT (Part:BBa K5267009) with 10 nM thapsigargin resulted in a significant increase in the expression of the NanoLuc reporter gene, with the thapsigargin-treated group exhibiting a 15.5-fold higher expression compared to the control group. This demonstrated that the synthetic NFAT promoter Pmin_6×NFAT can sense and characterize intracellular calcium ion concentration as expected.
Nluc expression increase with time could be detected in cells transfected with pNC104(PNFAT_6-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT (Figure. 3).


Figure 3. Step-response dynamics of translated cells under thapsigargin treatment. HEK293T cells were transfected with pNC104(PNFAT_6-IgK-Nluc).
Cells were treated with either DMSO or thapsigargin 6 hours post transcription. Data represents mean±SD of nanoluc expression levels measured at 24 h after melatonin stimulation (n = 3 independent experiments).

Sequence

Top:
agctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttta
tacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattg
gaaaattttatacacgttagactttagagggtatataatggaagctcgacttccagctt


Reference

[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.