Latest revision as of 13:23, 2 October 2024

fgRNA Entry Vector MbCas12a-SpCas9

This part integrates the crRNA of MbCas12a (BBa_K5237206) and the sgRNA of SpCas9 (BBa_K5237209) into a single fusion guide RNA (fgRNA). This fgRNA was functionally validated (see detailed characterization data below). MbCas12a (BBa_K5237001), SpCas9 (BBa_K5237002) and the novel fusion MbdCas12a-SpdCas9 (BBa_K5237003) can all utilize the fgRNA to target/bind two different genomic loci simultaneously. The fgRNA works in combination with both, the catalytically active as well as inactive Cas9 and Cas12a versions, facilitating multiplexed genome editing (with catalytically active Cas) as well as DNA-DNA stapling and hence 3D genome engineering in eukaryotes (with catalytically inactive Cas). Employing the fgRNA design described here, we successfully showed simultaneous genome editing at two different loci in human cells. Furthermore, the fgRNA enabled us to induce spatial proximity of otherwise separate gene regulatory elements (enhancer and promoter) with the catalytically inactive dSpCas9 and dMbCas12a.
In context of our part collection, the PICasSO toolbox, part BBa_K5237000 is the core component, since it enables the creation and programming of our so-called CRISPR/Cas staples: An innovative, trimeric complex comprised of a fgRNA, dCas9 and dCas12a employed for tethering two distinct genomic loci (see section 4.5 below), hence enabling rational engineering of the 3D genome conformation in living cells.

While synthetic biology has in the past focused on engineering the genomic sequence of organisms, the 3D spatial organization of DNA is well-known to be an important layer of information encoding in particular in eukaryotes, playing a crucial role in gene regulation and hence cell fate, disease development, evolution, and more. However, tools to precisely manipulate and control the genomic spatial architecture are limited, hampering the exploration of 3D genome engineering in synthetic biology. We - the iGEM Team Heidelberg 2024 - have developed PICasSO, a powerful molecular toolbox for rationally engineering genome 3D architectures in living cells, based on various DNA-binding proteins.

The PICasSO part collection offers a comprehensive, modular platform for precise manipulation and re-programming of DNA-DNA interactions using engineered "protein staples" in living cells. This enables researchers to recreate naturally occurring alterations of 3D genomic interactions, such as enhancer hijacking in cancer, or to design entirely new spatial architectures for artificial gene regulation and cell function control. Specifically, the fusion of two DNA binding proteins enables to artificially bring otherwise distant genomic loci into spatial proximity. To unlock the system's full potential, we introduce versatile chimeric CRISPR/Cas complexes, connected either at the protein or - in the case of CRISPR/Cas-based DNA binding moieties - the guide RNA level. These complexes are referred to as protein- or Cas staples, respectively. Beyond its versatility with regard to the staple constructs themselves, PICasSO includes robust assay systems to support the engineering, optimization, and testing of new staples in vitro and in vivo. Notably, the PICasSO toolbox was developed in a design-build-test-learn engineering cycle closely intertwining wet lab experiments and computational modeling and iterated several times, yielding a collection of well-functioning and -characterized parts.

At its heart, the PICasSO part collection consists of three categories.
(i) Our DNA-binding proteins include our finalized Cas staple experimentally validated using an artificial "enhancer hijacking" system as well as "half staples" that can be combined by scientists to compose entirely new Cas staples in the future. We also include our Simple staples comprised of particularly small, simple and robust DNA binding domains well-known to the synthetic biology community, which serve as controls for successful stapling and can be further engineered to create alternative, simpler, and more compact staples.
(ii) As functional elements, we list additional parts that enhance and expand the functionality of our Cas and Basic staples. These consist of staples dependent on cleavable peptide linkers targeted by cancer-specific proteases or inteins that allow condition-specific, dynamic stapling in vivo. We also include several engineered parts that enable the efficient delivery of PICasSO's constructs into target cells, including mammalian cells, with our new interkingdom conjugation system.
(iii) As the final category of our collection, we provide parts that underlie our custom readout systems. These include components of our established FRET-based proximity assay system, enabling users to confirm accurate stapling. Additionally, we offer a complementary, application-oriented testing system based on a luciferase reporter, which allows for straightforward experimental assessment of functional enhancer hijacking events in mammalian cells.

The following table gives a comprehensive overview of all parts in our PICasSO toolbox. The highlighted parts showed exceptional performance as described on our iGEM wiki and can serve as a reference. The other parts in the collection are versatile building blocks designed to provide future iGEMers with the flexibility to engineer their own custom Cas staples, enabling further optimization and innovation in the new field of 3D genome engineering.

Our part collection includes:

DNA-Binding Proteins: Modular building blocks for engineering of custom staples to mediate defined DNA-DNA interactions in vivo
BBa_K5237000	Fusion Guide RNA Entry Vector MbCas12a-SpCas9	Entry vector for simple fgRNA cloning via SapI
BBa_K5237001	Staple Subunit: dMbCas12a-Nucleoplasmin NLS	Staple subunit that can be combined with crRNA or fgRNA and dSpCas9 to form a functional staple
BBa_K5237002	Staple Subunit: SV40 NLS-dSpCas9-SV40 NLS	Staple subunit that can be combined with a sgRNA or fgRNA and dMbCas12a to form a functional staple
BBa_K5237003	Cas Staple: SV40 NLS-dMbCas12a-dSpCas9-Nucleoplasmin NLS	Functional Cas staple that can be combined with sgRNA and crRNA or fgRNA to bring two DNA strands into close proximity
BBa_K5237004	Staple Subunit: Oct1-DBD	Staple subunit that can be combined to form a functional staple, for example with TetR. Can also be combined with a fluorescent protein as part of the FRET proximity assay
BBa_K5237005	Staple Subunit: TetR	Staple subunit that can be combined to form a functional staple, for example with Oct1. Can also be combined with a fluorescent protein as part of the FRET proximity assay
BBa_K5237006	Simple Staple: TetR-Oct1	Functional staple that can be used to bring two DNA strands in close proximity
BBa_K5237007	Staple Subunit: GCN4	Staple subunit that can be combined to form a functional staple, for example with rGCN4
BBa_K5237008	Staple Subunit: rGCN4	Staple subunit that can be combined to form a functional staple, for example with rGCN4
BBa_K5237009	Mini Staple: bGCN4	Assembled staple with minimal size that can be further engineered
Functional Elements: Protease-cleavable peptide linkers and inteins are used to control and modify staples for further optimization for custom applications
BBa_K5237010	Cathepsin B-cleavable Linker: GFLG	Cathepsin B-cleavable peptide linker that can be used to combine two staple subunits to make responsive staples
BBa_K5237011	Cathepsin B Expression Cassette	Expression cassette for the overexpression of cathepsin B
BBa_K5237012	Caged NpuN Intein	A caged NpuN split intein fragment that undergoes protein trans-splicing after protease activation, which can be used to create functionalized staple subunits
BBa_K5237013	Caged NpuC Intein	A caged NpuC split intein fragment that undergoes protein trans-splicing after protease activation, which can be used to create functionalized staple subunits
BBa_K5237014	Fusion Guide RNA Processing Casette	Processing cassette to produce multiple fgRNAs from one transcript, that can be used for multiplexed 3D genome reprogramming
BBa_K5237015	Intimin anti-EGFR Nanobody	Interkingdom conjugation between bacteria and mammalian cells, as an alternative delivery tool for large constructs
BBa_K4643003	IncP Origin of Transfer	Origin of transfer that can be cloned into the plasmid vector and used for conjugation as a means of delivery
Readout Systems: FRET and enhancer recruitment readout systems to rapidly assess successful DNA stapling in bacterial and mammalian cells
BBa_K5237016	FRET-Donor: mNeonGreen-Oct1	FRET donor-fluorophore fused to Oct1-DBD that binds to the Oct1 binding cassette, which can be used to visualize DNA-DNA proximity
BBa_K5237017	FRET-Acceptor: TetR-mScarlet-I	Acceptor part for the FRET assay binding the TetR binding cassette, which can be used to visualize DNA-DNA proximity
BBa_K5237018	Oct1 Binding Casette	DNA sequence containing 12 Oct1 binding motifs, compatible with various assays such as the FRET proximity assay
BBa_K5237019	TetR Binding Cassette	DNA sequence containing 12 Oct1 binding motifs, can be used for different assays such as the FRET proximity assay
BBa_K5237020	Cathepsin B-Cleavable Trans-Activator: NLS-Gal4-GFLG-VP64	Readout system that responds to protease activity, which was used to test cathepsin B-cleavable linker
BBa_K5237021	NLS-Gal4-VP64	Trans-activating enhancer, that can be used to simulate enhancer hijacking
BBa_K5237022	mCherry Expression Cassette: UAS, minimal Promoter, mCherry	Readout system for enhancer binding, which was used to test cathepsin B-cleavable linker
BBa_K5237023	Oct1 - 5x UAS Binding Casette	Oct1 and UAS binding cassette, that was used for the simulated enhancer hijacking assay
BBa_K5237024	TRE-minimal Promoter- Firefly Luciferase	Contains firefly luciferase controlled by a minimal promoter, which was used as a luminescence readout for simulated enhancer hijacking

1. Sequence Overview

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
INCOMPATIBLE WITH RFC[12]
Illegal NheI site found at 339
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
INCOMPATIBLE WITH RFC[1000]
Illegal BsaI site found at 571
Illegal SapI site found at 662
Illegal SapI.rc site found at 280

2. Usage and Biology

2.1 Discovery and Mechanism of CRISPR/Cas9

Figure 2: The CRISPR/Cas System A and B, schematic structure of Cas9 and Cas12a with their sgRNA/crRNA, sitting on a DNA strand with their respective PAMs. The sgRNA/crRNA spacer sequence binds the DNA target strand via complementary base pairing. In case of Cas9 the spacer is located at the 5' prime end, for Cas12a at the 3' end of the gRNA. The scaffold of the gRNA forms a specific secondary structure enabling it to be bound by the Cas protein. DNA cleavage sites are indicated by the scissors.

In 2012, Jinek et al. discovered the use of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas system to induce double-strand breaks in DNA in a programmable manner. Since then, the system has been well established as a tool for genome editing. The CRISPR/Cas system, which originates from the bacterial immune system, is constituted by a ribonucleoprotein complex. For class 1 CRISPR systems, an RNA guide is complexed by multiple Cas proteins, whereas class 2 systems consist of a singular protein binding RNA. The class 2 type II system describes all ribonucleoprotein complexes with Cas9 (Pacesa et al., 2024). They include a CRISPR RNA (crRNA), which specifies the target sequence with a ~20 nucleotide (nt) spacer sequence, and a transactivating CRISPR RNA (tracrRNA), which induces the processing by the Cas protein (Jinek et al., 2012) (Fig. 2 A). Furthermore, a specific three nucleotide sequence (NGG) at the 3' end in the targeted DNA is needed for Cas9 DNA binding and cleavage. This is referred to as the protospacer adjacent motif (PAM) (Sternberg et al., 2014). The most commonly used Cas9 protein is SpCas9 or SpyCas9, which originates from Streptococcus pyogenes (Pacesa et al., 2024).

A significant enhancement of the CRISPR/Cas9 system was the introduction of single guide RNAs (sgRNA[s]), which combine the functions of a tracrRNA and crRNA (Jinek et al., 2012; Mali et al., 2013). Moreover, Cong et al. (2013) established precise targeting of human endogenous loci by designing the 20 nt spacer sequence accordingly.

2.2 Differences between Cas9 and Cas12a

Over the following years, several additional class 2 CRISPR/Cas systems have been discovered, including the Cpf1 system, which has been classified as Cas12a since then (Zetsche et al., 2015). Cas12a forms a class 2 type V system. In contrast to the type II systems, the Cas12a RNA guide only requires a crRNA to mediate Cas12a DNA targeting. Moreover, Cas12a is capable of processing long precursor crRNA transcripts into several, single/independent crRNAs, whereas Cas9 requires the RNase III enzyme and tracrRNA for this process (Paul and Montoya, 2020). This crRNA is often also referred to as a guide RNA (gRNA). However, the stem loop that is formed when binding the Cas protein is structurally distinct to the Cas9 gRNA and positioned on the 5' side of the crRNA (Fig. 2 B). Similarly, the PAM (TTTV) is also on the 5' side (Pacesa et al., 2024). Cas9 possesses RuvC and HNH domains that are catalytically active, each of which cleaves one of the DNA strands at the same site, resulting in the formation of blunt end cuts (Nishimasu et al., 2014). Cas12a possesses one RuvC-like domain that creates staggered cuts with overhangs that are about 5nt long (Paul and Montoya, 2020).

2.3 Dead Cas Proteins and their Application

Specific mutations of these domains result in catalytic inactivity and therefore allow for the creation of nickases that only cut one of the DNA strands, or Cas protein mutants that retain their DNA binding capability, but have no catalytic activity (Koonin et al., 2023) (Kleinstiver et al., 2019). The latter are referred to as dead Cas proteins or dCas9 and dCas12a. These Cas proteins can be used to activate (CRISPRa) or inhibit (CRISPRi) the expression of genes by fusing them to effector domains and targeting the respective genes via complementary spacer sequences (Kampmann, 2017). A common approach for CRISPRa involves fusing Cas9 with the transcriptional activator, such as VP64 or VPR (Kampmann, 2017).

3. Assembly and Part Evolution

Building on insights of our fusion Cas engineering cycle and findings from Kweon (2017), fgRNAs were designed by combining the sgRNA from SpCas9 with the crRNA from MbCas12a. Specifically the 3'-end of the MbCas12a gRNA was linked to the 5'-end of the SpCas9 gRNA (through genetic fusion). With this approach, the two spacer sequences are fused directly, ensuring a minimal distance between the two DNA strands to be co-bound by the Cas staple complex. This design also facilitates efficient cloning of different spacer sequences, as both spacers can be obtained as one consecutive sequence encoded on a single oligo pair. Linking the crRNA and sgRNA further enables multiplexing, as Cas12a can inherently process crRNA repeats that are expressed from one single transcript, enabling multiplexing. The entry vector includes a U6 promoter, the MbCas12a scaffold, a bacterial promoter driving ccdB expression, and the SpCas9 scaffold. Successful spacer integration leads to the removal of the ccdB gene, allowing bacterial growth to be used as an indicator for cloning success.
A conventional gRNA expression vector containing an MbCas12a crRNA scaffold under the control of an U6 promoter was selected as the basis for entry vector cloning. The vector and a ccdB-SpCas9 scaffold construct were PCR amplified and fitting overhangs for SapI were introduced (Fig. 3). Golden Gate assembly (GGA) with Esp3I was used to create the final plasmid. The transformation was carried out in the ccdB-resistant XL1 Blue E. Coli strain.

Figure 3: Construction Process of fgRNAs Using the Entry Vector. The ccdB gene is excised using SapI in a Golden Gate assembly reaction. Desired Cas12a and Cas9 spacer sequence combinations can be easily inserted using annealed oligonucleotides with matching overhangs, resulting in a functional, complete fgRNA. Due to the cytotoxic nature of ccdB, only transformants carrying a correctly assembled fgRNA construct can survive, streamlining the cloning process.

As a first step to characterize the functionality of fgRNAs, we performed an experiment in which we simultaneously edited two fgRNA-targeted genomic sites in mammalian cells (HEK239T). The genes VEGFA and FANCF were selected as targets for Cas12a and Cas9 and each target was tested with each Cas protein using corresponding fgRNA designs. Editing efficiency was analyzed with the T7 Endonuclease I (T7EI) assay widely used in the CRISPR field. Controls included the use of conventional crRNAs and sgRNAs with their cognate Cas effectors as positive controls, and non-targeting guides as negative controls. Desired spacer sequences were ordered as synthetic oligos, annealed, and cloned in via GGA utilizing SapI.

Figure 4: Initial Experimental Setups to Assess the Functionality of fgRNAs Fusion Guide RNAs can be used for multiplex genome editing by simultaneously guiding catalytically active Cas12a and Cas9 to two distinct loci. Similarly, fgRNAs allow for CRISPRa by guiding the dCas9-VP64 transcriptional activator to a minimal promoter. These figure shows the basic experiments used for fgRNA characterization before applying it for DNA-DNA stapling (see below).

Table 1: A list of all the different spacers we cloned and tested within the fgRNA
CCR5	TGACATCAATTATTATACAT
Dnmt1	GCTCAGCAGGCACCTGCCTC
Fancf	GGCGGGGTCCAGTTCCGGGA
Oct1 (BBa_K5237018)	ATGCAAATACTGCACTAGTG
Runx1	CCTTCGGAGCGAAAACCAAG
TetO (BBa_K5237019)	TCTCTATCACTGATAGGGAG
VEGFA	CTAGGAATATTGAAGGGGGC

Table 2: A list of all the different linkers we cloned and tested within the fgRNA design
5 nt linker	ATGCG
10 nt linker	ATGCGAGCTG
10 nt Poly A linker	CAAAACAACA
20 nt linker	TGGCGGCGTGCTGACCGCTA
20 nt Poly A linker	CAAAACAACAATCAAAACAA
30 nt Poly A linker	CAAAACAACAATCAAAACAA ATCAAAACAA
40 nt Poly A linker	CAAAACAACAATCAAAACAACAAAACAA CAATCAAAACAA

We constructed a second entry vector incorporating an AsCas12a scaffold (5' taatttctactcttgtagat 3') instead of MbCas12a. The sequence of the AsCas12a scaffold was the only modification present in the resulting composite part. This vector was tested on the VEGFA and FANCF loci to assess functionality of the encoded fgRNA.

4. Results

In the following section, we provide a detailed quantitative characterization of part BBa_K5237000, tested under various experimental conditions and use cases.

4.1 Editing Endogenous Loci With Fusion Guide RNAs

To show that our fusion gRNA design results in an active CRISPR/Cas ribonucleoprotein complex, a series of different fgRNAs were cloned, each carrying spacer sequences specific to the VEGFA and FANCF target genes. HEK293T cells were then co-transfected with the Cas protein and (f)gRNA encoding constructs. The editing rate was tested 72h after transfection via a T7 endonuclease I assay.
Here, AsCas12a and SpCas9 were used. The AsCas12a spacer, in this case, targets VEGFA, while the SpCas9 spacer targets FANCF. Samples included either (i) conventional single gRNAs co-expressed with the corresponding Cas proteins (positive controls), (ii) the fgRNA co-expressed with only one of the two Cas proteins (as control for Cas ortholog dependency) and (iii) the fgRNA with both Cas proteins simultaneously co-expressed (Fig. 5). The conventional sgRNAs resulted in potent editing ("editing" refers to the observed indel frequency) for both target genes (45% for VEGFA and 15% for FANCF). Note that editing rates for FANCF were consistently lower in all experiments, which likely is due to the specific properties of the FANCF-targeted locus. Importantly, as hoped, targeting FANCF with fgRNAs resulted in noticeable editing of about 10%, when we added the SpCas9 alone or both Cas proteins into the sample. For VEGFA, the AsCas12a only sample resulted in approximately 20% editing in combination with the fgRNA, while adding both Cas proteins led to approximately 40%. These initial results confirmed that our fgRNA design indeed functions, enabling simultaneous recuitment of two different Cas proteins to separate loci in human cells.

Figure 5: fgRNAs Enable Efficient Editing of Endogenous Loci. Indel rates were assessed 72h post transfection via T7EI assay. Editing % was determined by measuring band intensities; Editing % = 100 x (1 - (1- cleaved band/uncleaved band))^1/2. The schematic at the top shows the composition of each fgRNA. The symbols indicate, which Cas variants and which (f)gRNA were present in each sample.

4.2 Efficient Fusion Guide RNA-Mediated Editing With Various Cas Orthologs

After showing efficient editing, the next step was to evaluate the capabilities of the fgRNAs. To this end, we tested fgRNAs in combination with different Cas12a orthologs. Following some initial testing, we decided to use MbCas12a together with SpCas9 in subsequent experiments, since MbCas12a turned out to be more effective than AsCas12a in a dual luciferase assay when co-transfected with SpCas9 (Fig. 6). Of note, SpCas9 reproducibly showed high potency.

Figure 6: Comparison of AsCas12a and MbCas12a with a Dual Luciferase Reporter Assay. HEK293T cells were co-transfected with the indicated constructs and firefly and Renilla luminescence intensity was measured 48 h after transfection. Relative luciferase units correspond to firefly luciferase photon counts normalized to Renilla luciferase photon counts (Renilla luciferase serves as transfection control). Potent activity of CRISPR-Cas effectors result in knockdown of the firefly luciferase and hence smaller values. Samples correspond to cells co-transfected with a firefly luciferase targeting fgRNA and the constructs encoding the indicated CRISPR-Cas effector (see color legend). Data represent the mean +/- SD from n = 3 independent experiments. Statistical analysis was performed using 1way ANOVA with Tukey's multiple comparisons test. ***p<0.001,

Additionally, to determine whether the differences in editing rates observed in the preliminary assays were due to the specific properties of the targeted loci or the distinct characteristics of the Cas orthologs used, the spacers were tested in two configurations. In one setup, the fgRNA-encoded spacer for Cas12a targeted FANCF, while the spacer for SpCas9 targeted VEGFA; in the other, the targets were reversed. To more precisely assess the impact that the utilization of a fgRNA design has on the editing rates, conventional crRNAs/sgRNAs were tested separately or, alternatively, combined in one sample.
Combining a conventional crRNA/sgRNAs with the individual Cas proteins in the same sample showed no significant difference in editing rates (Fig. 7) as compared to using them in separate samples. While the fgRNA led to an overall lower editing rate as compared to the conventional guide RNAs, editing was still clearly noticeable for both targeted loci, indicating that the fgRNA works in principle. While editing efficiency for VEGFA remained consistently around 20%, the editing rate for FANCF dropped significantly, but was still detecable. Under identical conditions, MbCas12a consistently exhibited lower editing rates compared to SpCas9 when targeting the same gene, which is expected based on experience with this Cas orthologs in the CRISPR field.

Figure 7: FgRNA-mediated dual genome editing with SpCas9 and MbCas12a. In A and B the editing rates were determined 72h post transfection via T7EI assay. Editing % was determined by measuring band T7 cleavage band intensities as explained above. The schematic at the top shows the composition of the fgRNA. Below each spacer, the target gene is indicated. The symbols below indicate which parts are included in each sample. The fgRNA in A and B differs by the order of used spacer sequences (FANCF-VEGFA vs VEGFA-FANCF).

4.3 Fusion Guide RNAs are Compatible with Linkers of Various lengths

To further assess the effect of the genomic locus on the editing rate, we included CCR5 as an additional gene target. For this assay, a fgRNA with a 20 nt long linker sequence between the two spacers was included. As above, fgRNA-mediated editing was assessed via T7E1 assay in HEK293T cells. The editing rate for VEGFA was again relatively consistent throughout the samples (Fig. 8). For CCR5, the editing rate with the conventional sgRNAs was in a similar range as that of VEGFA (at about 30%), but dropped to below 10% in the fgRNA sample. The addition of the 20 nt linker had no effect on the editing rates compared to no linker.

Figure 8: Fusion gRNAs with A 20 Nucleotide Spacer Still Mediate Editing For CCR5 and VEGFA HEK293T cells were co-transfected with the indicated components followed by assessing editing rates 72h post transfection via T7EI assay. Editing % was determined as described above. The schematic at the top shows the composition of the fgRNA. Below each spacer, the targeted gene is indicated. The symbols below indicate which parts are included in each sample. Cas12a targets VEGFA and Cas9 targets CCR5 in this case.

4.4 Fusion Guide RNAs Enable Efficient Activation of Gene Expression via CRISPRa

The data above provide manifold evidence that fgRNAs can indeed be employed for simultaneous genome editing at two defined loci with catalytically active Cas9 and Cas12a. Next, to establish the foundation for the use of fgRNAs as scaffold for Cas-staple protein assembly and hence 3D genome enineering, we next combined fgRNAs with catalytically dead Cas9 and -12a in an CRISPRa (CRISPR activation of gene expression) experiment. For this, we intended to recruit the transcriptional activator VP64 to a firefly luciferase reporter gene to induce expression. The VP64 protein is genetically fused to the catalytically inactive Cas9 protein, which is then guided by gRNAs to the luciferase-driving minimal promoter. More specifically, the gRNAs here target a TetO repeat sequence, which is positioned 5' of a minimal tata site. The luciferase reporter activity was then quantified and photon counts for Firefly luciferase (to be activated by CRISPRa) were normalized to the photon counts of Renilla luciferase, which is expressed on a separate plasmid under an ubiquitous promoter (transfection control). In two biological replicates we saw similar relative luciferase activity with fgRNA as a guide compared to a sgRNA (Fig. 9).

Figure 9: The Efficacy of CRISPRa is Comparable Between Our fgRNAs and Conventional sgRNAs. The schematic at the top shows the composition of the fgRNA. Symbols show which parts were co-expressed in each sample. The empty spacer control is a negative control with a gRNA lacking the TetO-targeting spacer, thus preventing binding of dCas9-VP64 to the Firefly-luciferase driving promoter. Firefly luciferase activity was measured 48h post transfection and, as above, normalized to an ubiquitously expressed Renilla luciferase (transfection control). The tetO repeats were targeted by Cas9-VP64, once with a sgRNA (center) and once with a fgRNA (right) that carried a non-targeting spacer sequence for Cas12a.

4.5 A Proof-Of-Concept for 3D Genome Engineering: Stapling Two DNA Strands Together In Human Cells Using fgRNAs

Having demonstrated the excellent compatibility of the fgRNA design with simultaneous genome editing at two distinct loci and CRISPR activation, we set out to provide a proof-of-concept for engineering 3D genome conformation in living cells. To achieve this, we designed an experiment to "staple together" two regulatory elements—a synthetic enhancer and a minimal promoter—located on different strands of DNA. We developed a two-plasmid system consisting of an enhancer plasmid and a reporter plasmid. The reporter plasmid encodes firefly luciferase driven by a minimal promoter containing several repeats of a Cas9-targeted sequence, while the enhancer plasmid includes a Gal4 binding site (UAS) positioned next to several repeats of a Cas12a-targeted sequence. We co-expressed these two plasmids with dCas9, dCas12, an fgRNA simultaneously co-targeting (i.e., tethering) the reporter and enhancer plasmids, and Gal4-VP64. This resulted in the expression of luciferase (Fig. 10, Panel A). Different linker lengths (as mentioned above) were tested for the fgRNA. Firefly luciferase values were normalized against ubiquitous renilla expression as a transfection control. Using no linker between the two spacers produced luciferase activity values similar to the baseline control (i.e., no reporter activation) (Fig. 10, Panel B). Excitingly, however, the stepwise extension of the fgRNA linker (i.e., the linker separating the Cas12a and Cas9 spacer elements) from 20 nt to 40 nt led to progressively increasing, and ultimately potent, luciferase reporter activation. This experiment provided the first demonstration that an fgRNA with an optimized linker can effectively "staple" two otherwise separate pieces of DNA. As this experimental readout—mediated by the spatial proximity of two separate regulatory elements—mimics naturally occurring enhancer hijacking events, we refer to this setup as "synthetic enhancer hijacking."

Figure 10: Applying Fusion Guide RNAs for Cas staples: Proof-Of-Concept 3D Genome Engineering Via Synthetic Enhancer Hijacking. A, schematic overview of the assay is shown. An enhancer plasmid and a reporter plasmid are brought into proximity by an fgRNA-Cas staple complex, which co-targets and tethers both plasmids. Target sequences were included in multiple repeats upstream of the functional elements. Firefly luciferase serves as the reporter gene, while the enhancer is composed of multiple Gal4 repeats bound by a Gal4-VP64 fusion protein. B, HEK293T cells were co-transfected with the reporter plasmid, the enhancer plasmid, a Gal4-VP64-encoding plasmid as well dCas9 and dCas12. Firefly luciferase activity was measured 48 hours post transfection and normalized to ubiquitously expressed Renilla luciferase. Observed differences were tested for statistical significance using ordinary one-way ANOVA with Dunn's method for multiple comparisons. (*p < 0.05; **p < 0.01; ***p < 0.001; mean +/- SD from n = 3 independent experiments). The assay included sgRNAs and fgRNAs with linker lengths varying between 0 nt to 40 nt as indicated.

5. In Silico Characterization using DaVinci

We developed the in silico model DaVinci for rapid engineering and development of our PICasSO system. DaVinci acts as a digital twin to PICasSO, designed to understand the forces acting on our system, refine experimental parameters, and find optimal connections between protein staples and target DNA.
We calibrated DaVinci with literature and our own experimental affinity data obtained via EMSA assays and purified proteins. This enabled us to simulate enhancer hijacking in silico, providing valuable input for the design of further experiments. Additionally, we apply the same approach to our part collection.

DaVinci is divided into three phases: static structure prediction, all-atom dynamics simulation, and long-ranged dna dynamics simulation. Here, we applied the last step to our parts, characterizing structure and dynamics of the dna-binding interaction.

5.1. Enhancer Hijacking is Successfully Studied In Silico

Figure 11: Cas stapled plasmids.

With the Cas staple, we aimed to simulate the principles of enhancer hijacking experiments we conducted in the lab. For these experiments, we modeled the two plasmids also used in the wet lab (BBa_K5237023 and BBa_K5237024). On top of the two plasmids, we modeled the Cas staple by applying a “DNA-DNA tethering force" throughout our simulation, selectively on the regions targeted by the fgRNA. This force was based on simulation data acquired in earlier phases of DaVinci. As there is no suitable model available that also simulates proteins, this proved to be the most effective modeling strategy.

Our simulation showed the expected behavior, holding the target sequences of the Cas staple (Fig. 12). Overall, these exciting results demonstrate that we can successfully model the core principles of enhancer hijacking with a total of 20 thousand simulated nucleotides in silico.

Figure 12: Fusion Cas staples hold stapled nucleotides in close proximity.

5.2. Cas Staple Forces do not Disturb DNA Strand Integrity

Figure 13: Cas stapled plasmids.

Next, we aimed to stress test our system to determine the amount of force required to induce DNA double-strand breaks. To achieve this, we used an identical setup to the previous experiment but instead of experimentally determined forces, we used artificial forces of varying strength. It is important to know that our in silico model responds to forces that cause double-strand breaks by scattering the nucleotides across the simulation box. As the specified bonds cannot actually break within the simulation, the phosphate backbone bonds become severely distorted and exhibit erratic behavior in the simulation videos. From our extensive simulations, we concluded that the forces required to damage the DNA are approximately 320 times (Fig. 15) and 680 times greater (Fig. 16) than the forces exerted by the Cas staple, respectively.

This provides important evidence regarding the safety of our staple approach for 3D genome engineering: According to our model, DNA-DNA tethering with our Cas staples is not expected to have a negative effect on the DNA stability.

Figure 14: Applying a force that is 270 times greater
than the predicted force typically exerted by a Cas staple on DNA.

Figure 15: Applying a force that is 320 times greater
than the predicted force typically exerted by a Cas staple on DNA.

Figure 16: Applying a force that is 680 times greater
than the predicted force typically exerted by a Cas staple on DNA.

Figure 17: Applying a force that is more than 1000 times greater
than the predicted force typically exerted by a Cas staple on DNA.

5.3. DaVinci Helps to Design Multi-Staple Arrangements

Figure 18: Double Cas stapling within 40 nucleotide distance induces double-strand breaks.

Finally, we simulated the behavior of multiple staples at once. Therefore, we expanded our previously introduced experimental setup by a second Cas staple.
In a first approach, we targeted an additional region next to the original chosen one. This region is 40 nucleotides away from the first target region on the plasmid displayed in blue connecting it to the opposite site of the orange plasmid, therefore bringing both ends of the orange plasmid together (Fig. 18).
Our simulation predicted that with these staple points, DNA double-strand breaks would occur as clearly visible by the scattered nucleotides (Fig. 19).

Figure 19: Double Cas stapling within 40 nucleotide distance induces double-strand breaks.

Figure 20: Stable multiplexing with 2 Cas staples. On the blue plasmid, the Cas binding sequences are 980 nucleotides apart.

To simulate a setup where we expect no double-strand breaks, we increased the distance between the stapling sites on the blue plasmid (BBa_K5237023) from 40 to 980 nucleotides (Fig. 20).
With this increased distance between stapling sites, we observed a stabilized system. Most interestingly, the non-stapled regions showed maximum distances close to 500 nm, indicating that the two staples led to more compact plasmid structures.

In conclusion, we show that applying multiple staples on the same structures can lead to double-strand breaks if the staples are positioned closely to one another. However, increasing the separation of staples leads to a stable system without DNA damage. Thus, it is definitely possible to multiplex Cas staples, thereby increasing the compactness of DNA structures (Fig. 21). This shows the potential of creating complex regulatory networks by bringing genetic elements into spatial proximity with a multitude of Cas protein staples.

Figure 21: Increasing the distance between Cas staple targets to 980 nucleotides stabilizes multiplexing.

6. References

Aregger, M., Xing, K., & Gonatopoulos-Pournatzis, T. (2021). Application of CHyMErA Cas9-Cas12a combinatorial genome-editing platform for genetic interaction mapping and gene fragment deletion screening. Nature Protocols, 16, 4722-4765. https://doi.org/10.1038/s41596-021-00595-1

Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P. D., Wu, X., Jiang, W., Marraffini, L. A., & Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819-823. https://doi.org/10.1126/science.1231143

Gonatopoulos-Pournatzis, T., Aregger, M., Brown, K. R., Farhangmehr, S., Braunschweig, U., Ward, H. N., Ha, K. C. H., Weiss, A., Billmann, M., Durbic, T., Myers, C. L., Blencowe, B. J., & Moffat, J. (2020). Genetic interaction mapping and exon-resolution functional genomics with a hybrid Cas9-Cas12a platform. Nature Biotechnology, 38, 638-648. https://doi.org/10.1038/s41587-020-0437-z

Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816-821. https://doi.org/10.1126/science.1225829

Kampmann, M. (2017). CRISPRi and CRISPRa screens in mammalian cells for precision biology and medicine. ACS Chemical Biology, 13, 406-416. https://doi.org/10.1021/acschembio.7b00657

Kleinstiver, B. P., Sousa, A. A., Walton, R. T., Tak, Y. E., Hsu, J. Y., Clement, K., Welch, M. M., Horng, J. E., Malagon-Lopez, J., Scarfò, I., Maus, M. V., Pinello, L., Aryee, M. J., & Joung, J. K. (2019). Engineered CRISPR-Cas12a variants with increased activities and improved targeting ranges for gene, epigenetic and base editing. Nature Biotechnology, 37, 276-282. https://doi.org/10.1038/s41587-018-0011-0

Koonin, E. V., Gootenberg, J. S., & Abudayyeh, O. O. (2023). Discovery of diverse CRISPR-Cas systems and expansion of the genome engineering toolbox. Biochemistry, 62, 3465-3487. https://doi.org/10.1021/acs.biochem.3c00159

Kweon, J., Jang, A.-H., Kim, D.-e., Yang, J. W., Yoon, M., Rim Shin, H., Kim, J.-S., & Kim, Y. (2017). Fusion guide RNAs for orthogonal gene manipulation with Cas9 and Cpf1. Nature Communications, 8. https://doi.org/10.1038/s41467-017-01650-w

Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-guided human genome engineering via Cas9. Science, 339, 823-826. https://doi.org/10.1126/science.1232033

Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., & Nureki, O. (2014). Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell, 156, 935-949. https://doi.org/10.1016/j.cell.2014.02.001

Pacesa, M., Pelea, O., & Jinek, M. (2024). Past, present, and future of CRISPR genome editing technologies. Cell, 187, 1076-1100. https://doi.org/10.1016/j.cell.2024.01.042

Paul, B., & Montoya, G. (2020). CRISPR-Cas12a: Functional overview and applications. Biomedical Journal, 43, 8-17. https://doi.org/10.1016/j.bj.2019.10.005

Sternberg, S. H., Redding, S., Jinek, M., Greene, E. C., & Doudna, J. A. (2014). DNA interrogation by the CRISPR RNA-guided endonuclease Cas9. Nature, 507, 62-67. https://doi.org/10.1038/nature13011

Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., & Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 163, 759-771. https://doi.org/10.1016/j.cell.2015.09.038

Difference between revisions of "Part:BBa K5237000"