Difference between revisions of "Part:BBa K5267009"

(→‎Special design)
(→‎Result)
Line 63: Line 63:
 
'''Figure 2. NFAT activation in response to calcium ion signaling. '''
 
'''Figure 2. NFAT activation in response to calcium ion signaling. '''
 
<br>HEK-293T cells were transfected with plasmids containing different promoters with 1×/5×/6×/7×NFAT elements respectively.  Data are mean±SD of NanoLuc expression levels measured at 48 h after thapsigargin stimulation (n = 3 independent experiments).Upon a 48-hour incubation period, stimulation of the NFAT promoter with 10 nM thapsigargin resulted in a mean augmentation of the NanoLuc reporter gene expression to a magnitude that was 1.96-fold superior to that ascertained in the absence of thapsigargin induction.
 
<br>HEK-293T cells were transfected with plasmids containing different promoters with 1×/5×/6×/7×NFAT elements respectively.  Data are mean±SD of NanoLuc expression levels measured at 48 h after thapsigargin stimulation (n = 3 independent experiments).Upon a 48-hour incubation period, stimulation of the NFAT promoter with 10 nM thapsigargin resulted in a mean augmentation of the NanoLuc reporter gene expression to a magnitude that was 1.96-fold superior to that ascertained in the absence of thapsigargin induction.
 +
 +
<br>Nluc expression increase with time could be detected in cells transfected with pNC102(PNFAT_1-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT (Figure.3).
 +
<html>
 +
 +
<figure class="figure">
 +
<div style="width=100%;height=auto;align-items:center">
 +
<img src="https://static.igem.wiki/teams/5267/i-m-zhangrenjie/016.jpg" class="figure-img img-fluid rounded"  height="400px">
 +
 +
</figure>
 +
 +
</html>
  
 
===Sequence===
 
===Sequence===

Revision as of 10:02, 2 October 2024


Pmin_6*NFAT promoter

Transpose and respond to calcium ion signals Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Profile

Name: Pmin_6*NFAT promoter
Base Pairs: 219bp
Origin: Homo sapiens
Properties: Transpose and respond to calcium ion signals


Usage and Biology

Nuclear factor of activated T cells (NFAT) was first identified more than two decades ago as a major stimulation-responsive DNA-binding factor and transcriptional regulator in T cells. NFAT is a family of transcription factors. It was originally discovered in activated T cells as a transcription factor capable of binding to the promoter of human interleukin-2 (IL2) to rapidly induce its expression. Widely expressed in a variety of animal tissues and cells, NFAT is a key regulatory point of multiple intracellular signal transduction pathways, and also plays an important role in immune system, nervous system development, axon growth, and nervous system diseases，in this project it used to indirectly monitor effects of increases in the intracellular Ca2+ concentrations.[1]


Special design

In an effort to non-invasively assess the impact of elevated intracellular calcium ion (Ca2+) concentrations, we have developed a series of Ca2+-inducible NanoLuc reporters predicated on the Ca2+-dependent activation of dimeric nuclear factor of activated T cells (NFAT), as depicted in Figure 1[2].
These reporters incorporate a varying number of tandem repeats (1×, 5×, 6×, and 7×) of a pseudo-palindromic NFAT response element (NFAT-RE) derived from the interleukin-4 (IL4) promoter sequence (5′-TACATTGGAAAATTTTAT-3′), which is anticipated to drive the transcription of the NanoLuc reporter gene. (Figure 1)
To elucidate the effects of intracellular Ca2+ concentration increments, human embryonic kidney 293 cells (HEK293) were co-transfected with expression plasmids encoding each of the newly designed NanoLuc reporters. This approach enables the indirect monitoring of the cellular response to fluctuations in intracellular Ca2+ concentrations.[3]


Figure 1. Construction of a pseudo-palindromic NFAT-response element (RE)-directed nanoluciferase(Nanoluc) reporter system.

Function test

Thapsigargin (TG) is a known ER stress inducer that increases intracellular calcium (Ca +) concentration by inhibiting the calcium atpase (SERCA pump) in the ER. This increased calcium concentration can activate a variety of cell signaling pathways, including the NFAT (nuclear factor of activated T cells) pathway, thereby analyzing the sensitivity and activation threshold of the NFAT pathway.

Method

We introduced the expression vectors encoding the novel NanoLuc-reporter constructs into HEK293T cells via co-transfection, followed by the application of thapsigargin to elicit an intracellular calcium ion (Ca2+) response. The experimental paradigm encompassed three replicate experiments alongside a non-transfected control group (BBa_K5267049). Subsequent to a 48-hour exposure to thapsigargin, the luminescence intensity of the reporter element NanoLuc (measured as relative light units, RLU) was quantified across all experimental cohorts to assess the transcriptional activity induced by the treatment.

Result

Figure 2. NFAT activation in response to calcium ion signaling.
HEK-293T cells were transfected with plasmids containing different promoters with 1×/5×/6×/7×NFAT elements respectively. Data are mean±SD of NanoLuc expression levels measured at 48 h after thapsigargin stimulation (n = 3 independent experiments).Upon a 48-hour incubation period, stimulation of the NFAT promoter with 10 nM thapsigargin resulted in a mean augmentation of the NanoLuc reporter gene expression to a magnitude that was 1.96-fold superior to that ascertained in the absence of thapsigargin induction.


Nluc expression increase with time could be detected in cells transfected with pNC102(PNFAT_1-IgK-Nluc) treated with Thapsigargin (10nM). Thapsigargin stimulation less than 1nM could not activate Nluc expression downstream of 6×NFAT (Figure.3).

Sequence

Top:
agctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattggaaaatttta
tacacgttctagctacattggaaaattttatacacgttctagctacattggaaaattttatacacgttctagctacattg
gaaaattttatacacgttagactttagagggtatataatggaagctcgacttccagctt


Reference

[1] M. R. Müller and A. Rao, “NFAT, immunity and cancer: a transcription factor comes of age,” Nat. Rev. Immunol., vol. 10, no. 9, pp. 645–656, Sep. 2010, doi: 10.1038/nri2818.
[2] W. Zhang, T. Takahara, T. Achiha, H. Shibata, and M. Maki, “Nanoluciferase Reporter Gene System Directed by Tandemly Repeated Pseudo-Palindromic NFAT-Response Elements Facilitates Analysis of Biological Endpoint Effects of Cellular Ca2+ Mobilization,” Int. J. Mol. Sci., vol. 19, no. 2, p. 605, Feb. 2018, doi: 10.3390/ijms19020605.
[3] K. A. Strait, P. K. Stricklett, R. M. Kohan, and D. E. Kohan, “Identification of Two Nuclear Factor of Activated T-cells (NFAT)-response Elements in the 5′-Upstream Regulatory Region of the ET-1 Promoter,” J. Biol. Chem., vol. 285, no. 37, pp. 28520–28528, Sep. 2010, doi: 10.1074/jbc.M110.153189.