Difference between revisions of "Part:BBa K091112:Experience"

(→‎User Reviews)
 
(6 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
 
This part worked as expected in HB101 cells.<br>
 
This part worked as expected in HB101 cells.<br>
 +
New information provided by the MoWestern/Davidson team in 2009. See note at the bottom of the page. <br>
 +
<br>
 
[[Image:Trial1.png]]<br>
 
[[Image:Trial1.png]]<br>
 
[[Image:Trial2.png]]
 
[[Image:Trial2.png]]
Line 8: Line 10:
  
 
===User Reviews===
 
===User Reviews===
 +
The MWSU/Davidson iGEM 2009 team sequenced this promoter isolated from cells that had grown for several weeks when we obtained gel results indicating that the part might be too large. The team found that there was a 35 bp spontaneous insertion within this promoter directly before the suffix. We believe that the ''E.coli'' cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion:
 +
 +
  TGTGTGGAATTGTGAGCGGATAACAATTTCACACA
 +
 +
Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. Users are encouraged to sequence parts using this promoter during the construction process. We have some versions that are wild-type and others that are mutated. If you build a new version yourself, do not maintain the plasmid in cultures for very long. Freeze down a stock as soon as possible to avoid the introduction of a silencing mutation in the promoter.
 +
 +
 
<!-- DON'T DELETE --><partinfo>BBa_K091112 StartReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K091112 StartReviews</partinfo>
 
<!-- Template for a user review
 
<!-- Template for a user review
Line 16: Line 25:
 
<I>Username</I>
 
<I>Username</I>
 
|width='60%' valign='top'|
 
|width='60%' valign='top'|
−
Enter the review information here.
+
|};
−
|};The MWSU/Davdison iGEM 2009 team sequenced this promoter after there was little to no expression using this it to express GFP and after obtaining what seemed like faulty results during gel verification of its size. The team found that there was a 33 bp insertion within this promoter before the suffix. We believe that the
+
−
E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and selection against an attribute that did not necessarily improve its fitness.
+
 
<!-- End of the user review template -->
 
<!-- End of the user review template -->
 
<!-- DON'T DELETE --><partinfo>BBa_K091112 EndReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_K091112 EndReviews</partinfo>

Latest revision as of 12:58, 31 October 2009

This part worked as expected in HB101 cells.
New information provided by the MoWestern/Davidson team in 2009. See note at the bottom of the page.

Trial1.png
Trial2.png


Applications of BBa_K091112

User Reviews

The MWSU/Davidson iGEM 2009 team sequenced this promoter isolated from cells that had grown for several weeks when we obtained gel results indicating that the part might be too large. The team found that there was a 35 bp spontaneous insertion within this promoter directly before the suffix. We believe that the E.coli cells may have mutated the promoter to silence its activity in an effort to conserve energy and select against an attribute that did not necessarily improve its fitness. Here is the 35 bp insertion: 

 TGTGTGGAATTGTGAGCGGATAACAATTTCACACA

Our experience with this part and our conclusion concerning the mutation have been added to the promoter description in the Parts Registry so that other teams will be aware of this unique possibility. Users are encouraged to sequence parts using this promoter during the construction process. We have some versions that are wild-type and others that are mutated. If you build a new version yourself, do not maintain the plasmid in cultures for very long. Freeze down a stock as soon as possible to avoid the introduction of a silencing mutation in the promoter.


UNIQ783f6b8bf1bb8185-partinfo-00000000-QINU UNIQ783f6b8bf1bb8185-partinfo-00000001-QINU